View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20491_high_11 (Length: 302)
Name: NF20491_high_11
Description: NF20491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20491_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 43116029 - 43116299
Alignment:
| Q |
1 |
agtataatttttaatacatatttcctagcacatgttaacttaaattgattgaaaacatgtgctttcaccccattgtgcgacttgattagcaacacgtcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116029 |
agtataatttttaatacatatttcctagcacatgttaacttaaattgattgaaaacatgtgctttcaccccattgtgcgacttgattagcaacacgtcta |
43116128 |
T |
 |
| Q |
101 |
atataagaaaattgtaaattaaattgacacaatcctctactatgagacctaaagagacctaaagaggagtgattttgccattggtctgcaattgctttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116129 |
atataagaaaattgtaaattaaattgacacaatcctctactat----------gagatctaaagaggagtgattttgccattggtctgcaattgctttaa |
43116218 |
T |
 |
| Q |
201 |
ttgtgttaagggaatccaattccacaattaggacctagatcaaatgatcgtgcctagattagcaatttttggtaggctcgt |
281 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116219 |
ttgtgttaagggagtccaattccacaattaggacctagatcaattgatcgtgcctagattagcaatttttggtaggctcgt |
43116299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 157 - 215
Target Start/End: Complemental strand, 7239852 - 7239794
Alignment:
| Q |
157 |
acctaaagaggagtgattttgccattggtctgcaattgctttaattgtgttaagggaat |
215 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
7239852 |
acctaaataggagtgattttactgctggtctgcaattgttttaattgtgttaagggaat |
7239794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University