View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20491_high_18 (Length: 212)
Name: NF20491_high_18
Description: NF20491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20491_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 63 - 198
Target Start/End: Complemental strand, 47663953 - 47663818
Alignment:
| Q |
63 |
ctcaactcattttcctgcactgttccatcaaaataagatttgattctttgaagtgtaacaaaaaatcaaaatattcatgtttcacttgctatcttatctt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47663953 |
ctcaactcattttcctgcactgttccatcaaaataagatttgattctttgaagtgtaacaaaaaatcaaaatatccatgtttcacttgctatcttatctt |
47663854 |
T |
|
| Q |
163 |
gatcccatgattcatatgtgatatacaaagtattat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47663853 |
gatcccatgattcatatgtgatatacaaagtattat |
47663818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University