View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20491_low_20 (Length: 206)
Name: NF20491_low_20
Description: NF20491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20491_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 21 - 190
Target Start/End: Original strand, 8242198 - 8242367
Alignment:
| Q |
21 |
gaatacactcagaaagaagaatatgatataccttgacttcattgtggagagaacgagattttagttcaaaactgaagaaaacaatattgtaattgaagtg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8242198 |
gaatacactcagaaagaagaatatgatataccttgacttcattgtggagagaacgagattttagttcaaaactgaagaaaacaatattgtaattgaagtg |
8242297 |
T |
 |
| Q |
121 |
aagaagagagagataattgtggacatttaagaaatatgtgtgagactggttccttttaatgtcatgagat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
8242298 |
aagaagagagagataattgtggacatttaagaaatttgtgtgagatcggttccttttaatgtcatgagat |
8242367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University