View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20492_high_1 (Length: 497)
Name: NF20492_high_1
Description: NF20492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20492_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 142 - 482
Target Start/End: Original strand, 31781079 - 31781419
Alignment:
| Q |
142 |
gattattcttgtttattatgaatcttgttcttgnnnnnnnnagggtgaattgaaattgctgattcaattcgatggggaaggtgatgacgacgacggagaa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31781079 |
gattattcttgtttattatgaatcttgttcttgttttttttagggtgaattgaaattgctgattcaattcgatggggaaggtgatgacgacgacggagaa |
31781178 |
T |
|
| Q |
242 |
gaggaaagggaggagaaaattgaagaaatctgggaccaagtatttgaaacctggaaccctagctcagcttcgttgtagcaagtatttaggttctggatcg |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31781179 |
gaggaaagggaggagaaaattgaagaaatctgggaccaagtatttgaaacctggaaccctagctcagcttcgttgtagcaagtatttaggttctggatcg |
31781278 |
T |
|
| Q |
342 |
ggtgctggtagggtttgtaatgatattgggaagaaaagggtggagcttttgaatttggagaagaatgaggatcatgaaggtaaggtgtttgataaaagtc |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31781279 |
ggtgctggtagggtttgtaatgatattgggaagaaaagggtggagcttttgaatttggagaagaatgaggatcatgaaggtaaggtgtttgataaaagtc |
31781378 |
T |
|
| Q |
442 |
cgctgatgctttcgccggtgaatttggttaaacagagtagt |
482 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31781379 |
cgctgatgctttcgccggtgaatttggttaaacagagtagt |
31781419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 426 - 476
Target Start/End: Original strand, 1939995 - 1940045
Alignment:
| Q |
426 |
gtgtttgataaaagtccgctgatgctttcgccggtgaatttggttaaacag |
476 |
Q |
| |
|
|||||||| |||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
1939995 |
gtgtttgacaaaagtcctctgatgctttttcctgtgaatttggttaaacag |
1940045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University