View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20492_low_5 (Length: 347)
Name: NF20492_low_5
Description: NF20492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20492_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 50885838 - 50886076
Alignment:
| Q |
19 |
cacaatgcttgttgttgcttactgccccgctctcactggcattcttcccctcttcccgacgacaatatccccatctcaaaaccttaaaaccaaaactaac |
118 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50885838 |
cacaatgcttgttgttgcttacctcaccgctctcattggcattcttcccctcttcccgacgacaatatccccatctcaaaaccttaaaaccaaaactcac |
50885937 |
T |
|
| Q |
119 |
tttt-acggacccttcaattccaccagcaccaacctttttgatgttatacctaggacatctatctaccatagaaccttccatatcacttcggacaacact |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50885938 |
tttttacggacccttcaattccaccagcgccaacctttttgatgtcatacctaggacatctatctaccatagaaccttccatatcacttcggacaacact |
50886037 |
T |
|
| Q |
218 |
ggaagtgaaactgtcatctccctgcttaacaagtccgac |
256 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50886038 |
ggaagtgaaactgtcatctccctgtttaacaagtccgac |
50886076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 187 - 335
Target Start/End: Original strand, 50886077 - 50886225
Alignment:
| Q |
187 |
tagaaccttccatatcacttcggacaacactggaagtgaaactgtcatctccctgcttaacaagtccgacacaatctttttaaaaagccatttagactct |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
50886077 |
tagaaccttccatatcacttcggacaacaccggaagtgaaactgtcatctccctatttaataagtccgacataatctttctaaaaagccatttagactct |
50886176 |
T |
|
| Q |
287 |
gggatgacaccgaaaaaatcacttccttcaacgcctctttatctgatga |
335 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50886177 |
gagatgacaccgaaaaaatcacttccttcaacacctctttatctgatga |
50886225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University