View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20492_low_8 (Length: 304)
Name: NF20492_low_8
Description: NF20492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20492_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 5 - 299
Target Start/End: Complemental strand, 43366915 - 43366624
Alignment:
| Q |
5 |
cgcctcctcatttccgccatctccgtctgccttctccttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatcctt |
104 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366915 |
cgcctcctcatttcctccatctccgtctgccttctctttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatcctt |
43366816 |
T |
 |
| Q |
105 |
ctacttcaattacattcctcattccattctgctgctgtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366815 |
ctacttcaattacattcctcattccattttgctgctgtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcag |
43366716 |
T |
 |
| Q |
205 |
caatccccatttcacattccggtaatcaaacaatgttctcaccttcnnnnnnnatgcattttttgttatgttgctaatatcttccctttgcttct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43366715 |
caatccccatttcacattccggtaatcaaacaatgttctcacctt---tttttattcattttttgttatgttgctaatatcttccttttgtttct |
43366624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University