View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20493_high_3 (Length: 246)
Name: NF20493_high_3
Description: NF20493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20493_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 147 - 240
Target Start/End: Complemental strand, 8394366 - 8394273
Alignment:
| Q |
147 |
agcaaagaaccaaagggatgggtaaggaaagggtcaaaatcagataagaaaattctggttgactagtttgattaaataattgacaaggtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8394366 |
agcaaagaaccaaagggatgggtaaggaaagggtcaaaatcagataagaaaattctggttgactagtttgattaaataattgacaaggtctctg |
8394273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 8394500 - 8394409
Alignment:
| Q |
1 |
tttattgttatgatgtgtgtgtttaggattagtatatagttggggaaataaaaaaggtttggttaattgtaatgtttgaaatttgaatgtta |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8394500 |
tttattgttatgatgtgtgtgtttaggattagtatatagttggggaaataaaaaaggtttggttaattgtaatgtttgaaatttgaatgtta |
8394409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University