View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20494_high_4 (Length: 294)
Name: NF20494_high_4
Description: NF20494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20494_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 21 - 169
Target Start/End: Original strand, 47268503 - 47268651
Alignment:
| Q |
21 |
atgctccaaacgatagaaataagccatctctttgctttttctctcttcaatatctctctcgctgcaaactctcacctaccaaaccaactgtaagtgtgct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
47268503 |
atgctccaaacgatagaaataagccatctctttgctttttctctcttcaatatctctctcgcagcaaactctcgcctaccaaacgaactgtaagtgtgct |
47268602 |
T |
 |
| Q |
121 |
taacaatgtgcgtatatgaaatttacaaggcaattaaacttgatctaaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47268603 |
taacaatgtgcgtatatgaaatttacaaggcaattaaacttgatctaaa |
47268651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 191 - 278
Target Start/End: Original strand, 47268693 - 47268780
Alignment:
| Q |
191 |
tgaaaaaattgataacactcaaactactaatctatttaggttaaaatttgcgagtgcaatccatgtttactttttaggtaatccaaaa |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47268693 |
tgaaaaaattgataacactcaaactactaatctatttaggttaaaatttgcgagtgcaatccatgtttactttttaggtaatccaaaa |
47268780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 42596820 - 42596856
Alignment:
| Q |
17 |
actgatgctccaaacgatagaaataagccatctcttt |
53 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42596820 |
actgatgctccaaacgatagaaataagtcatctcttt |
42596856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 16871123 - 16871077
Alignment:
| Q |
56 |
tttttctctcttcaatatctctctcgctgcaaactctcacctaccaaac |
104 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
16871123 |
tttttctctcttcaatatc--tctcgcatcaaactctcacctaccaaac |
16871077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University