View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20494_high_7 (Length: 256)
Name: NF20494_high_7
Description: NF20494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20494_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 8154271 - 8154046
Alignment:
| Q |
10 |
aatatcatgtagtttgtgttcttttatagcataaaattgataaatttaaataaccaacatataagtacatggtcaacttgccaagtagcttaatggaatg |
109 |
Q |
| |
|
|||||||||||||||||| || |||||| ||| | ||||||||||||||||| |||| ||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8154271 |
aatatcatgtagtttgtggtcatttata-catgatattgataaatttaaatagccaagata--agtacaaggtcaacttgccaagtagcttaatggaatg |
8154175 |
T |
 |
| Q |
110 |
attttgaataaaatagaaacggggtgactttaaaaatagtggcatcacaacgtgtgcatcatattggctagaatttcttgttgcttaaaattttctacca |
209 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
8154174 |
attttgaataaaataaaaacggg-tgagtttaaaaatagtggcatcacaacgtgtgcatcatattggctagaatttcttgttgctaaaaattttctacga |
8154076 |
T |
 |
| Q |
210 |
aaaaactaacattttggtacattgacttca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8154075 |
aaaaactaacattttggtacattgacttca |
8154046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University