View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20494_low_8 (Length: 255)
Name: NF20494_low_8
Description: NF20494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20494_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 8154300 - 8154538
Alignment:
| Q |
1 |
tttagaactattgtaaggttttgagatggagaataacacacacagtgcaacagcaacagaaactgcaacgactattactagtgcaccctcaagctcaacg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8154300 |
tttagaactattataaggttttgagatggagaataacacaaacagtgcaacagcaacatcaactgcaacgactattactagtgcaccctcaagctcaacg |
8154399 |
T |
 |
| Q |
101 |
gtttcaagaattgttcttttagttttgagggtgttaacttttgtgtttcttctcattgctctcatagtcattgtcttaaccaaggaaactttagagacaa |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8154400 |
gtttcaagaattgttcttttacttttgagggtgttaacttttgtgtttcttctcattgctctcatagtcattgtcttaaccaaggaaactttagagacaa |
8154499 |
T |
 |
| Q |
201 |
gttttggtgaatcggaaattaagttcaacgatatccatg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8154500 |
gttttggtgaatcggaaattaagttcaacgatatccatg |
8154538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 80 - 195
Target Start/End: Original strand, 8162269 - 8162384
Alignment:
| Q |
80 |
agtgcaccctcaagctcaacggtttcaagaattgttcttttagttttgagggtgttaacttttgtgtttcttctcattgctctcatagtcattgtcttaa |
179 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
8162269 |
agtgcaccctcaagttcaacagtttcaagaactgttcttttacttttgagggtgttaacttttgtgttccttctcattgctttcatagtcattgtcttaa |
8162368 |
T |
 |
| Q |
180 |
ccaaggaaactttaga |
195 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
8162369 |
caaaggaaactttaga |
8162384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University