View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20494_low_9 (Length: 238)
Name: NF20494_low_9
Description: NF20494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20494_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 38520126 - 38520334
Alignment:
| Q |
11 |
cacagacaacaaatacgccttcatctgaagtgttgtcaatgctgcatagtctttgataaacactgctcaagtctagtaactaatactccctccatt---t |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38520126 |
cacaaacaacaaatacgccttcatctgaagtgtggtcaacgctgcatagtctttgataaacactgctcaagtctagtaactaatactccctccattattt |
38520225 |
T |
 |
| Q |
108 |
ctttacaacttataagggtcacattcagaattttgttcaatctcatatgacttctaacttgagaaatactaagacaaatatttattaactttttcaacaa |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38520226 |
ctttacaacttataagtgtcacattcagaattttgttcaatctcatatgacttctaacttgagaaatactaagacaaatattcattaactttttcaacaa |
38520325 |
T |
 |
| Q |
208 |
tattcgcat |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
38520326 |
tattcgcat |
38520334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University