View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20495_high_13 (Length: 204)
Name: NF20495_high_13
Description: NF20495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20495_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 23 - 187
Target Start/End: Complemental strand, 35815434 - 35815271
Alignment:
| Q |
23 |
ttattatatatagcagctagctagtaaaataatcctccaggcaaaccatgtccaaattgcaacaatattgcagacttagggtttctgttctgcttctagg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35815434 |
ttattatatatagcagctagctagtaaaataatcctccaggcaaaccatgtccaaattgcaacaatattgcagacttagggtttctgttctgcttctagg |
35815335 |
T |
 |
| Q |
123 |
gtttcaaatactacaaacgttgctgttgctctatccatatactcgacctc--ttttcctattttcat |
187 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
35815334 |
gtttcaaatactacaaacgt---tgttgctctatccatatacttgacctcttttttcctattttcat |
35815271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University