View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20495_high_5 (Length: 389)
Name: NF20495_high_5
Description: NF20495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20495_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 3e-58; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 11 - 146
Target Start/End: Original strand, 691690 - 691825
Alignment:
| Q |
11 |
ttattctcataaataagggtcttgtgatgagttgaaacatcacaattcaagcgcaacgaaaggaagtttcnnnnnnnggtacatgtcatatgccagtaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
691690 |
ttattctcataaataagggtcttgtgatgagttgaaacatcacaattcaagcgcaacgaaaggaagtttctttttttggtacatgtcatatgccagtaca |
691789 |
T |
 |
| Q |
111 |
taaaatgactcacatttaattgttaataaatgactt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
691790 |
taaaatgactcacatttaattgttaataaatgactt |
691825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 242 - 376
Target Start/End: Original strand, 692019 - 692153
Alignment:
| Q |
242 |
ctttggattcgatgctgttttttaagttgtagtttgccgttgtaaattannnnnnngggcgtcatgcaatgcaatatggtgccttggtgattttgtctgt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
692019 |
ctttggattcgatgctgttttttaagttgtagtttgccgttgtaaattatttttttgggcgtcatgcaatgcaatatggtgccttggtgattttgtctat |
692118 |
T |
 |
| Q |
342 |
taggtggattcaatcagcaaaagttttgagaaaag |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
692119 |
taggtggattcaatcagcaaaagttttgagaaaag |
692153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 151 - 245
Target Start/End: Original strand, 691860 - 691954
Alignment:
| Q |
151 |
aaattatgaaaaattgaagaactaacttttgaaggaccttttctaaatctccatacatatagtggattaacttatggaaattgcctgaattcttt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
691860 |
aaattatgaaaaattgaagaactaacttttgaaggaccttttctaaatctccatacatatagtggattaacttatggaaattgcctgaattcttt |
691954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 264 - 359
Target Start/End: Original strand, 659352 - 659447
Alignment:
| Q |
264 |
taagttgtagtttgccgttgtaaattannnnnnngggcgtcatgcaatgcaatatggtgccttggtgattttgtctgttaggtggattcaatcagc |
359 |
Q |
| |
|
|||||||||||||||| |||||||||| | | |||||| |||| ||||| |||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
659352 |
taagttgtagtttgcctttgtaaattattgttttgagtgtcatgtaatgaaatatagtgccttggtgattttatctgctaggtggactcaatcagc |
659447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 72
Target Start/End: Original strand, 658995 - 659047
Alignment:
| Q |
20 |
taaataagggtcttgtgatgagttgaaacatcacaattcaagcgcaacgaaag |
72 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
658995 |
taaacaagggtcttgtgaagagttgaaacatctcaatttaagagcaacgaaag |
659047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 310 - 376
Target Start/End: Original strand, 11565469 - 11565535
Alignment:
| Q |
310 |
atgcaatatggtgccttggtgattttgtctgttaggtggattcaatcagcaaaagttttgagaaaag |
376 |
Q |
| |
|
|||||| |||||| | || ||||||||| ||||||||||| |||||||| ||| ||||||| ||||| |
|
|
| T |
11565469 |
atgcaacatggtgtcatgatgattttgtttgttaggtggactcaatcagtaaaggttttgacaaaag |
11565535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University