View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_high_37 (Length: 328)
Name: NF20496_high_37
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 152 - 312
Target Start/End: Original strand, 16857680 - 16857840
Alignment:
| Q |
152 |
gtcatgctggctcatactcgattcttatccaatccgagtcatctcttattcgtcatatgttttt-ctgcaaactgtattannnnnnnnnnnnnattatta |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| || ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
16857680 |
gtcatgctggttcatactcgattcttatccaatccgagtcatctcttattcttcgtattttttttctgcaaactgtattattttttattttt-attatta |
16857778 |
T |
|
| Q |
251 |
caatgtcaatgatgaacaagacaattcatcaaactcgagtggggtatgtgagtgttaggttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16857779 |
caatgtcaatgatgaacaagacaattcatcaaactcgagtggggtatgtgagtgttaggttt |
16857840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University