View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_high_52 (Length: 262)
Name: NF20496_high_52
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_high_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 12680980 - 12680746
Alignment:
| Q |
17 |
cctttctctccctaaatgggtctctagtagtacagaattaatgccggaacagctcaagtttggccacatgcaaaataggttgggaacatgtacggtttgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12680980 |
cctttctctccctaaatgggtctctagtagtacagaattaatgccggaacagctcaagtttggccacatgcaaaatagcttgggaacatgtacggtttgg |
12680881 |
T |
 |
| Q |
117 |
tatacacctttcatgttaccctttatccttatgtgttgaattattgattacctgatttggttgtgcacagttaatcatctagagtcacttcttggaataa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12680880 |
tatacacctttcatgttaccctttatccttatgtgttgaattattgattacctgatttggttgtgcacagttaatcatctagagtcacttcttggaataa |
12680781 |
T |
 |
| Q |
217 |
ttcgaaagggtaccctgcatcttaaaccttttctt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12680780 |
ttcgaaagggtaccctgcatcttaaaccttttctt |
12680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University