View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_high_56 (Length: 246)
Name: NF20496_high_56
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 39078086 - 39078304
Alignment:
| Q |
18 |
aatcccaaaattttgtaaagataatataaagaatttttaagctttcaagttgaagattgtttgtaatgggaaatggtaaaactcacaacaaactagaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078086 |
aatcccaaaattttgtaaagataatataaagaatttttaagctttcaagttgaagattgtttgtaatgggaaatggtaaaactcacaacaaactagaata |
39078185 |
T |
|
| Q |
118 |
ggacattgaaatcagtgatgtatgtcacatggggttcagaaggtttttgcaagaaaaatatgagtggatgatgcaaacaaagttaggggaggnnnnnnnn |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078186 |
ggacattgaaatcagtgatgtatgtcacatggggttcagaaggtttttgcaagaaaaatatgagtggatgatgcaaacaaagttaggggaggaaaaaaaa |
39078285 |
T |
|
| Q |
218 |
tggtaccttttggcctatg |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39078286 |
tggtaccttttggcctatg |
39078304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University