View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_high_58 (Length: 241)
Name: NF20496_high_58
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_high_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 231
Target Start/End: Complemental strand, 28663480 - 28663269
Alignment:
| Q |
20 |
attcgaacggattgggttatgcatgagtatcgccttgatgataaagagtgtgaggacaacactggattacaggtatatccaacttatatgcatacttttt |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28663480 |
attcgaactgattgggttatgcatgagtatcgccttgatgataaagagtgtgaggacaacactggattacaggtatatacaacttatatgcatacttttt |
28663381 |
T |
 |
| Q |
120 |
cgtaactgagatcctctacaatcgactttacggtgcaatagagatatttctcctactacgttgcaccgtaaaacttgttgcagacgatccattttggtgt |
219 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28663380 |
cgtaacttagatcctctacaatcaactttacggtgcagtagagatatttctcctactacgttgcaccgtaaaacttgttgcagacgatccattttggtgt |
28663281 |
T |
 |
| Q |
220 |
gatgtgtctgtg |
231 |
Q |
| |
|
||||||| |||| |
|
|
| T |
28663280 |
gatgtgtgtgtg |
28663269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University