View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_high_64 (Length: 237)
Name: NF20496_high_64
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_high_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 37425412 - 37425217
Alignment:
| Q |
17 |
attcaaatatgcatattcaagccggattctagatagtgagtttgtgattaattatgttgctcctttataacaagcttgatgacattcttgtttttccagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37425412 |
attcaaatatgcatattcaagccggattctagatagtgagtttgtgattaattatgttgcgcctttataacaagcttgatggcattcttgtttttccaga |
37425313 |
T |
 |
| Q |
117 |
gtgttaaaattgtttttgaagtttttgaaaccttgtgtttgttatgactgaaatcagttttccttcnnnnnnngaaaccttgtggaggccatataaggct |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
37425312 |
gtgttaaaatt---------atttttgaaaccttgtgtttgttatgactgaaatcagttttccttctttttttgaaaccttgtggaggctatataaggct |
37425222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 139
Target Start/End: Complemental strand, 660049 - 660003
Alignment:
| Q |
93 |
tgatgacattcttgtttttccagcgtgttaaaattgtttttgaagtt |
139 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
660049 |
tgatgacattgttgttattccatggtgttaaaattgtttttgaagtt |
660003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University