View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_high_68 (Length: 228)
Name: NF20496_high_68
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_high_68 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 159 - 228
Target Start/End: Complemental strand, 13526055 - 13525986
Alignment:
| Q |
159 |
gatagattaaaatgtctaaagtttgtaacttaaaatcaaaatatctagtatttgttgattaaatgaccaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13526055 |
gatagattaaaatgtctaaagtttgtaacttaaaatcaaaatatctagtatttgttgattaagtgaccaa |
13525986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 13526335 - 13526295
Alignment:
| Q |
1 |
ggccccctttatataccttttaaaataaaaatattgttcca |
41 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13526335 |
ggccccctttatataccatttaaaataaaaatattgttcca |
13526295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 47644310 - 47644364
Alignment:
| Q |
157 |
aagatagattaaaatgtctaaagtttgtaacttaaa-atcaaaatatctagtatt |
210 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| |||||| ||||||||||| |
|
|
| T |
47644310 |
aagatagactaaaatgtctaatgtttgtaacttaaagatcaaagtatctagtatt |
47644364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 31557641 - 31557684
Alignment:
| Q |
166 |
taaaatgtctaaagtttgtaacttaaaatcaaaatatctagtattt |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
31557641 |
taaaatgtctaaagtttgtaactt--aatcaaagtatctagtattt |
31557684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University