View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20496_high_68 (Length: 228)

Name: NF20496_high_68
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20496_high_68
NF20496_high_68
[»] chr2 (2 HSPs)
chr2 (159-228)||(13525986-13526055)
chr2 (1-41)||(13526295-13526335)
[»] chr4 (1 HSPs)
chr4 (157-210)||(47644310-47644364)
[»] chr5 (1 HSPs)
chr5 (166-211)||(31557641-31557684)


Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 159 - 228
Target Start/End: Complemental strand, 13526055 - 13525986
Alignment:
159 gatagattaaaatgtctaaagtttgtaacttaaaatcaaaatatctagtatttgttgattaaatgaccaa 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
13526055 gatagattaaaatgtctaaagtttgtaacttaaaatcaaaatatctagtatttgttgattaagtgaccaa 13525986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 13526335 - 13526295
Alignment:
1 ggccccctttatataccttttaaaataaaaatattgttcca 41  Q
    ||||||||||||||||| |||||||||||||||||||||||    
13526335 ggccccctttatataccatttaaaataaaaatattgttcca 13526295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 210
Target Start/End: Original strand, 47644310 - 47644364
Alignment:
157 aagatagattaaaatgtctaaagtttgtaacttaaa-atcaaaatatctagtatt 210  Q
    |||||||| |||||||||||| |||||||||||||| |||||| |||||||||||    
47644310 aagatagactaaaatgtctaatgtttgtaacttaaagatcaaagtatctagtatt 47644364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 31557641 - 31557684
Alignment:
166 taaaatgtctaaagtttgtaacttaaaatcaaaatatctagtattt 211  Q
    ||||||||||||||||||||||||  ||||||| ||||||||||||    
31557641 taaaatgtctaaagtttgtaactt--aatcaaagtatctagtattt 31557684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University