View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_low_20 (Length: 428)
Name: NF20496_low_20
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 17 - 413
Target Start/End: Complemental strand, 5419403 - 5419007
Alignment:
| Q |
17 |
atcaatttggagtgtaatgtctaggtttgtatggggaatattgtggtcaatttatgtttgttgtgttttagttggtttattggtttcttcatttgtgttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5419403 |
atcaatttggagtgtaatgtctaggtttgtatggggaatattgtggtcaatttatgtttgttgtgttttggttggtttattggtttcttcatttgtgttt |
5419304 |
T |
 |
| Q |
117 |
agtggaattttgatcaagtatttcgtggagaaaccgattcggatgaatgaagttttgaatttcgattatactaagcttagtcctgtggcttatgttccga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419303 |
agtggaattttgatcaagtatttcgtggagaaaccgattcggatgaatgaagttttgaatttcgattatactaagcttagtcctgtggcttatgttccga |
5419204 |
T |
 |
| Q |
217 |
ttatttcgtgtgatggtgttgttatgggaaaagattatgagggtggttttgaagttgggaaggggatgatgatgggtgaaagggttatacctactagaca |
316 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419203 |
ttatttcgtgtgatggtgttgttaagggaaaagattatgagggtggttttgaagttgggaaggggatgatgatgggtgaaagggttatacctactagaca |
5419104 |
T |
 |
| Q |
317 |
taaagtgcaagttactgtttccttgagagtgccggagtcgggatataacagaaatcttggggtctttcaggtgattgcttatctctatccggttcat |
413 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5419103 |
taaagtgcaagttactgtttcgttgagagtgccggagtcgggatataacagaaatcttggggtctttcaggtgattgcttatctctatccggttcat |
5419007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University