View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_low_25 (Length: 399)
Name: NF20496_low_25
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Original strand, 44798757 - 44799147
Alignment:
| Q |
1 |
ttccgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798757 |
ttccgatggcattgcttttctcatttcatcaaccactgatttctcgtctctctctaatggttacatgggccttcctcattctgatcaagattcttacttt |
44798856 |
T |
|
| Q |
101 |
gcggttgaatttgatacaagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcttttgcttctgctg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798857 |
gcggttgaatttgatacgagttttgatccttctcttggtgacattaatggaaaccacgttggtattgatcttggcagtgttgtttcttttgcttctgctg |
44798956 |
T |
|
| Q |
201 |
atcttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgtttgggttagtta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798957 |
atcttctttcacgtcggattgatttgaaaagtgggaaaatcatcaatgcatggattgagtatagagatgatatgaaaatggttcgtgtttgggttagtta |
44799056 |
T |
|
| Q |
301 |
ctcttcaactagacctccaacaccaattattgcttcattcattgatctttctgagagatttaaagagtttatgcatgttggtttctctgct |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799057 |
ctcttcaactagacctccaacaccaattattgcttcattcattgatctttctgagagatttaaagagtttatgcatgttggtttctctgct |
44799147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University