View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_low_48 (Length: 292)
Name: NF20496_low_48
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 11 - 173
Target Start/End: Complemental strand, 42825578 - 42825413
Alignment:
| Q |
11 |
atgaatcaagcaatatctcactcttcctttttt-aatcattatgtgatttctttc-atttattat-tgatataatatcagtcgttacacatctgttgtct |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42825578 |
atgaatcaagcaatatctcacacttcctttttttaatcattatgtgatttctttctatttattaaatgatataatatcagtcgttacacatctgttgtct |
42825479 |
T |
 |
| Q |
108 |
catgtttgttgataaaaaataataaattcatacattcttattttattattaacctcgtgatatagc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42825478 |
catgtttgttgataaaaaataataaattcatacattcttattttattattaatctcgtgatatagc |
42825413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 34 - 84
Target Start/End: Original strand, 19040158 - 19040208
Alignment:
| Q |
34 |
ttccttttttaatcattatgtgatttctttcatttattattgatataatat |
84 |
Q |
| |
|
||||| || ||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
19040158 |
ttcctattctaatcatcatatgatttctttcttttattattgatataatat |
19040208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University