View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_low_52 (Length: 269)
Name: NF20496_low_52
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 47248278 - 47248508
Alignment:
| Q |
16 |
attatataagccgatatagacctcccgcaaaaattattacaccaaaatttgtgaactttgcaaagtctatcccaaacatcgtcatataaactgatgcagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47248278 |
attatataagccgatatagacctcccgcaaaaattattacaccaaaatttgtgaactttgcaaagtctctcccaaacatcgtcatataaactgatgcagt |
47248377 |
T |
|
| Q |
116 |
agacttatgtatg-tttttaataaaatactagtatcttttaaatggcaaatgttgcacttgttagttattattttgttagtgaaggagggaagttgaact |
214 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47248378 |
agacttatgtatgtttttttataaaatactagtatcttttaaatggcaaatgttgcacttgttagttattattttgttagtgaaggagggaagttgaact |
47248477 |
T |
|
| Q |
215 |
agtgacatttttattactttaatctctatgt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47248478 |
agtgacatttttattactttaatctctatgt |
47248508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University