View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_low_61 (Length: 240)
Name: NF20496_low_61
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_low_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 226
Target Start/End: Complemental strand, 53972039 - 53971836
Alignment:
| Q |
22 |
agtcaagagtatatttagataagataaagaaaatgtcttttaatttaatcgaagattttgaattataattcaatgttaaaaatacaacaatgttaaatca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53972039 |
agtcaagagtatatttagataagataaagaaaatgtcttttaatttaataggagattctgaattctaattcaatgttaaaaatacaacaatgttaaatca |
53971940 |
T |
 |
| Q |
122 |
tttgtcactcatttaaaattctatttgctttgaggtattgatctatgcaattctgcataaacagtaatgattgacacaaaaataacatagtacattaatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53971939 |
tttgtcactcatttaaaattctatttgctttgaggaattgatctatgcaattctgcat-aacagtaatgattgacacaaaaataacatagtacattaatt |
53971841 |
T |
 |
| Q |
222 |
catct |
226 |
Q |
| |
|
||||| |
|
|
| T |
53971840 |
catct |
53971836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University