View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_low_71 (Length: 228)
Name: NF20496_low_71
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 14144659 - 14144461
Alignment:
| Q |
1 |
aaagagggctagggtttagggattgtgatgtttgtggggtaatgaagcctttgagatgatagattagggttcacctatgatgccatgaattgaacttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||||||| ||||| |
|
|
| T |
14144659 |
aaagagggctagggtttagggattgtgatgtttgtggggtaatgaagcctttgagatgatagattagagttcttctatgacgccatgaattgaagttgaa |
14144560 |
T |
 |
| Q |
101 |
catagtgttgagttgaagtttgaaaatggattcagattgaaagggaaatgggttatatgcagtaacgaataccgcaccagttgctacagaagctcattc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
14144559 |
catagtgttgagttgaagtttgaaaatggattcagattgaaagggaaatgggttatatgcagtgacaaataccgcaccagttgctacagaagctcattc |
14144461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 14152641 - 14152513
Alignment:
| Q |
1 |
aaagagggctagggtttagggattgtgatgtttgtggggtaatgaagcctttgagatgatagattagggttcacctatgatgccatgaatt---gaactt |
97 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||||| |||| || ||||||| || ||||||||||| || || |||||||||| |||||| |
|
|
| T |
14152641 |
aaagagggttagggtttagggattgtgatgttagaggggtagtgaatcccttgagataattgattagggttcttctgtggcgccatgaattgaagaactt |
14152542 |
T |
 |
| Q |
98 |
gaacatagtgttgagttgaagtttgaaaa |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14152541 |
gaacatagtgttgagttgaagtttgaaaa |
14152513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University