View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20496_low_75 (Length: 218)
Name: NF20496_low_75
Description: NF20496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20496_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 22 - 201
Target Start/End: Complemental strand, 39145645 - 39145467
Alignment:
| Q |
22 |
tgttttttctttactgataggccaaatattcaatcttttctaagttatgtaacacatttcatataagcttatgacttatgagttacttttgtgannnnnn |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39145645 |
tgttttttctttactgataggccaaatattcaatcttttctaagttatgtaacacatttcatataagcctatgacttatgagttacttttgtgatttttt |
39145546 |
T |
 |
| Q |
122 |
nactgcagaagctactatacacaccaatgggtgaactgctgattcttcaaccagatgagaaattttcaccaagccataat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39145545 |
tactgcagaagctactatacacaccaatgggtgaactgctgattcttcaaccagatgagaaa-tttcaccaagccataat |
39145467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University