View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20497_low_29 (Length: 248)
Name: NF20497_low_29
Description: NF20497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20497_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 232
Target Start/End: Original strand, 37601900 - 37602118
Alignment:
| Q |
15 |
cataggtcattgaagcatcccaatattgttagatttaaagaggtacttagaggttttaatagtgtcattattatgcatcctatttcttataagaatttat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37601900 |
cataggtcattgaagcatcccaatattgttagatttaaagaggtacttagaggttttaatagtgtcattattatgcatcctatttcttataagaatttac |
37601999 |
T |
|
| Q |
115 |
ctggtgttattttctttgagctcatgcttgc-cnnnnnnnnngttattgaactagtgctttcttttgctacttcataccaactttataaaagtataaatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37602000 |
ctggtgttattttctttgagctcatgcttgctttttttttttgttattgaactagtgctttcttttgctacttcataccaactttataaaagtataaatg |
37602099 |
T |
|
| Q |
214 |
taatgagtgctgtatatac |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37602100 |
taatgagtgctgtatatac |
37602118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 39410685 - 39410729
Alignment:
| Q |
15 |
cataggtcattgaagcatcccaatattgttagatttaaagaggta |
59 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39410685 |
cataggtccttgaagcatcccaatatcattagatttaaagaggta |
39410729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University