View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20497_low_36 (Length: 221)
Name: NF20497_low_36
Description: NF20497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20497_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 117 - 192
Target Start/End: Complemental strand, 383405 - 383330
Alignment:
| Q |
117 |
taccttgcaagggcaataaagtttggttttagaaagcttttcttcttctttgatgttaaggcgtaaccaaccacta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
383405 |
taccttgcaagggcaataaagtttggttttagaaagcttttcttcttctttgatgttaaggcgtaaccaaccacta |
383330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 383503 - 383466
Alignment:
| Q |
18 |
ccatgtactatagtgatagattaatgtggaaaacgcag |
55 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
383503 |
ccatatactatagtgatagattaatgtggaaaatgcag |
383466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University