View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20497_low_36 (Length: 221)

Name: NF20497_low_36
Description: NF20497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20497_low_36
NF20497_low_36
[»] chr5 (2 HSPs)
chr5 (117-192)||(383330-383405)
chr5 (18-55)||(383466-383503)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 117 - 192
Target Start/End: Complemental strand, 383405 - 383330
Alignment:
117 taccttgcaagggcaataaagtttggttttagaaagcttttcttcttctttgatgttaaggcgtaaccaaccacta 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
383405 taccttgcaagggcaataaagtttggttttagaaagcttttcttcttctttgatgttaaggcgtaaccaaccacta 383330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 383503 - 383466
Alignment:
18 ccatgtactatagtgatagattaatgtggaaaacgcag 55  Q
    |||| |||||||||||||||||||||||||||| ||||    
383503 ccatatactatagtgatagattaatgtggaaaatgcag 383466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University