View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_high_25 (Length: 271)
Name: NF20498_high_25
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 55910632 - 55910377
Alignment:
| Q |
1 |
tccctgatacacctgctaaaataagaacctcattcctaagccccccatcaaatttgaaacagtggataaattggttaaaggggaataaaatgatgcaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55910632 |
tccctgatacacctgctaaaataagagcttcattcctaaaccccccatcaaatttgaaacagtggacaaattggttaaaggggaataaaatgatgcaaat |
55910533 |
T |
|
| Q |
101 |
gtgaataatgtacaactttgatgggaaaatgaaaatggatacaaggctttgtttcttgtcacctctt-ttttatatacaagcaagcaaatgaagcaaaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
55910532 |
gtgaataatgtacaactttgatgggaaaatgaaaatggatacaaggctttgtttcttgtcacctcttcttttatagacaagcaagcaaatgaagcaaaaa |
55910433 |
T |
|
| Q |
200 |
tttctccatttaaccatggcttttagatgtgaaatactctcaattgatacagtaat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910432 |
tttctccatttaaccatggcttttagatgtgaaatactctcaattgatacagtaat |
55910377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University