View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_high_32 (Length: 220)
Name: NF20498_high_32
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 34350206 - 34350020
Alignment:
| Q |
17 |
aggatgttaggtctactttcttcccctctttgcaacctcaattctccccttcaaattttgattcacattcaaaggtattacactattactgtactttgnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34350206 |
aggatgttaggtctactttcttcccctctttgcaacctcaattttccccttcaaattttgattcacattcaaaggtattacactattactctactt--ct |
34350109 |
T |
|
| Q |
117 |
nnnnnaccaaattattgtacttatctttttgaacaatgttagtttatgagttgatta-tctttgaattctaaaccttctagttagtatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34350108 |
tttttaccaaattattgtacttatctttttgaacaatgttagtttatgagttgattattctttgaattctaaaccttctagttagtatt |
34350020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University