View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_high_33 (Length: 203)
Name: NF20498_high_33
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 13 - 152
Target Start/End: Original strand, 42636292 - 42636430
Alignment:
| Q |
13 |
gagaagaaaaagccattatctattttagtgaattcaaggttctatttgtgcttcatttagtagtgttttcactacttatttcggattcctatacttttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
42636292 |
gagaagaaaaagccattatctattttagtgaattca-ggttctatttgtgcttcatttagtagtgttttcactacttatttcggactcgtatacttttgt |
42636390 |
T |
|
| Q |
113 |
agacattgctctatgagattttgcacatttaaagtggcaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42636391 |
agacattgctctatgagattttgcacatgtaaagtggcaa |
42636430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University