View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_low_22 (Length: 315)
Name: NF20498_low_22
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 106 - 310
Target Start/End: Original strand, 24751942 - 24752146
Alignment:
| Q |
106 |
tttaaggtaattagtttatgaaatctttcatttagaaaatgttcaagctccactttaataagtaatgtgaaacttctaactaacatttgctacacaataa |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24751942 |
tttaaggtaattagtttatgaaacctttcacttagaaaatgttcaagctccactttacaaagtaatgtgaaacttctaactaacatttgctacacaacaa |
24752041 |
T |
 |
| Q |
206 |
tatctccgtctatcaattcatgctcacctctcaaataaaaaccctttcatcaataataactaagttttcttggatctctaatcttttctttgtaatcata |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24752042 |
tatctccgtctatcaattcatgctcacctctcaaacgaaaatcctttcatcaataataactaagttttcttgaatctctaatcttttctttgtaatcata |
24752141 |
T |
 |
| Q |
306 |
attct |
310 |
Q |
| |
|
||||| |
|
|
| T |
24752142 |
attct |
24752146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University