View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_low_26 (Length: 281)
Name: NF20498_low_26
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 36702589 - 36702332
Alignment:
| Q |
19 |
tattaatcatgttttgaatatggattcacgatatagtttttcaatcaatgaataacaactttttatatttggtttttctcctgcaaaatcgttgatttgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
36702589 |
tattaatcatgttttgaatatggattcacgatatagtttttcaatcaatgaataacaactttttatatttggtttttttcctgcaaaatcgtcgatttgc |
36702490 |
T |
 |
| Q |
119 |
ata-taaaggatttgaaatttagagcatggccacttctttggatattatgatgtaaaatggatacatctatagatttgatattatatataatctaatcaa |
217 |
Q |
| |
|
||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36702489 |
ataataaagaatttgaaatttagagcatggtcacttctttggatattatgatgtaaaatggatacatctatagatttgatattatatataatctaatcaa |
36702390 |
T |
 |
| Q |
218 |
gcatttcttgatgttattcaatatttatagtcttcgtttattgatagtttcttctctc |
275 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36702389 |
gcatttcttgatgttattcaaaatttatagtcttcgtttattgatagtttctactctc |
36702332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University