View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_low_32 (Length: 239)
Name: NF20498_low_32
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_low_32 |
 | |
|
| [»] scaffold0415 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 2832466 - 2832254
Alignment:
| Q |
11 |
caaagggaattggcattattagttttccatttcaggttatggctgatgagtttgtaatcatgtgattttattgttttcaataacatttgcagagaggaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832466 |
caaagggaattggcattattagttttccatttcaggttatggctgatgagtttgtaatcatgtggttttattgttttcaataacatttgcagagaggaag |
2832367 |
T |
|
| Q |
111 |
atgaatgtgaagatagaaaactaaaattcgatgatatgagctcaagaaaccaattcagcaacggtgatacagatgaaagcactaaaagttatttttctga |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832366 |
atgaatgtgaagatataaaactaaaattcgatgatatgagctcaagaaaccaattcagcaacggtgatacagatgaaagcactaaaagttatttttctga |
2832267 |
T |
|
| Q |
211 |
agtaagcatttca |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2832266 |
agtaagcatttca |
2832254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 216
Target Start/End: Original strand, 40798191 - 40798316
Alignment:
| Q |
91 |
taacatttgcagagaggaagatgaatgtgaagatagaaaactaaaattcgatgatatgagctcaagaaaccaattcagcaacggtgatacagatgaaagc |
190 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||| |||| || |||||| ||||| ||| | | | || |||| || |||| ||||| | || |
|
|
| T |
40798191 |
taacatttgcagagaggaagaggaatgtgaagatgccaaacaaaaactcaatgataggagcttaaggacctatttaagcactggagatatagatggatgc |
40798290 |
T |
|
| Q |
191 |
actaaaagttatttttctgaagtaag |
216 |
Q |
| |
|
||||||||| ||| |||||||||||| |
|
|
| T |
40798291 |
actaaaagtgattcttctgaagtaag |
40798316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0415 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0415
Description:
Target: scaffold0415; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 91 - 124
Target Start/End: Original strand, 2816 - 2849
Alignment:
| Q |
91 |
taacatttgcagagaggaagatgaatgtgaagat |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
2816 |
taacatttgcagagaggaagaggaatgtgaagat |
2849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University