View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_low_33 (Length: 238)
Name: NF20498_low_33
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 3344681 - 3344468
Alignment:
| Q |
18 |
ttaactttgctatgatcgatgcaactgattttagcttctgaatttgatgatagtttgaaatt-------caccgaagacataattgaagtcatacataat |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3344681 |
ttaactttgctatgatcgatgcgactgattttagcttctgaatttgatgatagtttgaaatttaaataccaccgaagacataattgaagtcatacataat |
3344582 |
T |
 |
| Q |
111 |
tagatagtttaatttaggttcgataaagttctatgaatgtaacgatgttaaaacttttgacaaaaaactttactttttattgaaattttacaagacatta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3344581 |
tagatagtttaatttaggttcgataaagttctatgaatgcaacgatgttaaaacttttgaagaaaaactttactttttattgaaattttacaagacatta |
3344482 |
T |
 |
| Q |
211 |
cagattagtctgtg |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3344481 |
cagattagtctgtg |
3344468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 61
Target Start/End: Complemental strand, 3339527 - 3339497
Alignment:
| Q |
31 |
gatcgatgcaactgattttagcttctgaatt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3339527 |
gatcgatgcaactgattttagcttctgaatt |
3339497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University