View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20498_low_34 (Length: 224)
Name: NF20498_low_34
Description: NF20498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20498_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 39399375 - 39399587
Alignment:
| Q |
1 |
tgtaaattgggaatcacacaggttgtgttctttctccatttccctcttgctttgccatggaaatgtgaatctaatgttatcttctgatattgaaacttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39399375 |
tgtaaattgggaatcacacaggttgtgttctttctccatttccctcttgctttgccatggaaatgtgaatctaatgttatcttctgatattgaaacttac |
39399474 |
T |
 |
| Q |
101 |
tggatttaaacgtccatatttatagtgcacaattgctcatgcactggagaaaacaaaatatccagattcaggtacttattggaggaagttcgatgataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39399475 |
tggatttaaacgtccatatttatagtgcacaattgctcatgcactggagaaaacaaaatatccagattcaggtacttattggaggaagttcgatgataaa |
39399574 |
T |
 |
| Q |
201 |
taccatttttcat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39399575 |
taccatttttcat |
39399587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 213
Target Start/End: Complemental strand, 44516252 - 44516162
Alignment:
| Q |
123 |
tagtgcacaattgctcatgcactggagaaaacaaaatatccagattcaggtacttattggaggaagttcgatgataaataccatttttcat |
213 |
Q |
| |
|
||||||||||| || |||||||||||||| ||||||||||||||||||| || ||||||| ||| || || ||||||||||||||||||| |
|
|
| T |
44516252 |
tagtgcacaatcgcacatgcactggagaagacaaaatatccagattcagatatatattggaagaaatttgaggataaataccatttttcat |
44516162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University