View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20499_low_6 (Length: 232)
Name: NF20499_low_6
Description: NF20499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20499_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 2226534 - 2226441
Alignment:
| Q |
1 |
tagaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtattaa |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2226534 |
tagaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatttcatcgcatttaccctatgttacatagctaaagtattaa |
2226441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 92
Target Start/End: Complemental strand, 2219000 - 2218915
Alignment:
| Q |
7 |
tgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtatt |
92 |
Q |
| |
|
||||| ||||| || ||||||||| ||||||||||||||||| |||| |||| ||||| | |||||||||| ||||||||||| |
|
|
| T |
2219000 |
tgtcttaagatctcgcctttttcattcttttgttttggatctacatagttcattacatttggcttatgttacattgctaaagtatt |
2218915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 92
Target Start/End: Original strand, 36246953 - 36247042
Alignment:
| Q |
3 |
gaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtatt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || | ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
36246953 |
gaaatgtctaaagatttcacctttttcactcttttgttttggatctacaaagttcatcacatttaccttatgttacatagctaaagtatt |
36247042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 92
Target Start/End: Complemental strand, 19180987 - 19180898
Alignment:
| Q |
3 |
gaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtatt |
92 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || | ||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
19180987 |
gaaatgtctaaagatttcaactttttcactcttttgttttggatctacacagttcatcacatttaccttgtgttaaatagctaaagtatt |
19180898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University