View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20499_low_6 (Length: 232)

Name: NF20499_low_6
Description: NF20499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20499_low_6
NF20499_low_6
[»] chr1 (2 HSPs)
chr1 (1-94)||(2226441-2226534)
chr1 (7-92)||(2218915-2219000)
[»] chr2 (1 HSPs)
chr2 (3-92)||(36246953-36247042)
[»] chr8 (1 HSPs)
chr8 (3-92)||(19180898-19180987)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 2226534 - 2226441
Alignment:
1 tagaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtattaa 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
2226534 tagaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatttcatcgcatttaccctatgttacatagctaaagtattaa 2226441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 92
Target Start/End: Complemental strand, 2219000 - 2218915
Alignment:
7 tgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtatt 92  Q
    ||||| ||||| || ||||||||| ||||||||||||||||| ||||  ||||  |||||  | |||||||||| |||||||||||    
2219000 tgtcttaagatctcgcctttttcattcttttgttttggatctacatagttcattacatttggcttatgttacattgctaaagtatt 2218915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 92
Target Start/End: Original strand, 36246953 - 36247042
Alignment:
3 gaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtatt 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || |  ||||| |||||||| ||||||||||||||||||||||    
36246953 gaaatgtctaaagatttcacctttttcactcttttgttttggatctacaaagttcatcacatttaccttatgttacatagctaaagtatt 36247042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 92
Target Start/End: Complemental strand, 19180987 - 19180898
Alignment:
3 gaaatgtctaaagatttcacctttttcactcttttgttttggatctgcatatctcatcgcatttaccctatgttacatagctaaagtatt 92  Q
    ||||||||||||||||||| |||||||||||||||||||||||||| || |  ||||| |||||||| | ||||| ||||||||||||||    
19180987 gaaatgtctaaagatttcaactttttcactcttttgttttggatctacacagttcatcacatttaccttgtgttaaatagctaaagtatt 19180898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University