View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2049_low_10 (Length: 212)

Name: NF2049_low_10
Description: NF2049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2049_low_10
NF2049_low_10
[»] chr1 (83 HSPs)
chr1 (30-199)||(11067418-11067587)
chr1 (46-129)||(21884570-21884653)
chr1 (45-129)||(23930561-23930645)
chr1 (45-129)||(49251412-49251496)
chr1 (43-126)||(23464006-23464089)
chr1 (43-129)||(15774329-15774415)
chr1 (43-129)||(4354122-4354208)
chr1 (46-148)||(43092148-43092250)
chr1 (45-129)||(538346-538430)
chr1 (45-129)||(18923902-18923986)
chr1 (46-129)||(38019964-38020048)
chr1 (45-129)||(39433352-39433436)
chr1 (46-129)||(24661977-24662060)
chr1 (43-129)||(27745149-27745235)
chr1 (48-129)||(29491466-29491548)
chr1 (51-129)||(37733755-37733833)
chr1 (48-129)||(39238712-39238794)
chr1 (44-129)||(37490883-37490968)
chr1 (45-129)||(30649087-30649171)
chr1 (45-129)||(42831941-42832025)
chr1 (45-129)||(43555891-43555975)
chr1 (45-129)||(46116191-46116275)
chr1 (46-129)||(3532991-3533073)
chr1 (45-128)||(9408632-9408715)
chr1 (62-129)||(15368816-15368883)
chr1 (49-111)||(4429517-4429579)
chr1 (48-128)||(2052700-2052781)
chr1 (49-129)||(41833552-41833633)
chr1 (42-94)||(5172654-5172706)
chr1 (49-121)||(8261700-8261772)
chr1 (65-129)||(17056897-17056961)
chr1 (45-129)||(39434612-39434696)
chr1 (46-122)||(40814790-40814866)
chr1 (66-129)||(2208655-2208718)
chr1 (40-129)||(38021239-38021330)
chr1 (46-109)||(49916435-49916498)
chr1 (48-129)||(17350057-17350139)
chr1 (51-129)||(19793526-19793604)
chr1 (40-94)||(29331216-29331270)
chr1 (43-129)||(34560355-34560440)
chr1 (48-129)||(40678819-40678901)
chr1 (47-129)||(43837418-43837500)
chr1 (47-129)||(48110525-48110607)
chr1 (48-129)||(9768826-9768907)
chr1 (46-111)||(20357455-20357520)
chr1 (46-111)||(20562435-20562500)
chr1 (57-129)||(16110037-16110109)
chr1 (49-129)||(24168596-24168676)
chr1 (41-93)||(49010753-49010805)
chr1 (62-129)||(17064284-17064351)
chr1 (48-91)||(29442022-29442065)
chr1 (66-129)||(32711161-32711223)
chr1 (62-129)||(43237784-43237851)
chr1 (47-129)||(47763402-47763485)
chr1 (46-129)||(49606715-49606798)
chr1 (48-129)||(9527422-9527504)
chr1 (48-129)||(35111646-35111727)
chr1 (72-129)||(11405477-11405534)
chr1 (49-126)||(38851633-38851710)
chr1 (49-129)||(749604-749683)
chr1 (57-129)||(21635563-21635635)
chr1 (43-111)||(22346412-22346479)
chr1 (46-129)||(11213466-11213549)
chr1 (45-124)||(11907324-11907403)
chr1 (51-129)||(13870098-13870177)
chr1 (51-129)||(1721140-1721218)
chr1 (48-129)||(2643832-2643913)
chr1 (48-129)||(9410345-9410425)
chr1 (48-129)||(25819181-25819263)
chr1 (41-95)||(33059543-33059597)
chr1 (46-111)||(5680707-5680772)
chr1 (48-129)||(7906343-7906424)
chr1 (62-111)||(11802055-11802104)
chr1 (41-90)||(12073133-12073182)
chr1 (49-129)||(12553191-12553272)
chr1 (45-129)||(12866117-12866202)
chr1 (77-126)||(42801905-42801954)
chr1 (77-129)||(2903044-2903096)
chr1 (81-129)||(4616903-4616951)
chr1 (77-129)||(11238045-11238097)
chr1 (49-85)||(23990329-23990365)
chr1 (50-94)||(24014660-24014704)
chr1 (46-129)||(52833123-52833207)
[»] chr2 (78 HSPs)
chr2 (44-129)||(30474212-30474297)
chr2 (43-129)||(3179316-3179402)
chr2 (46-129)||(10262734-10262817)
chr2 (45-129)||(580800-580884)
chr2 (44-129)||(36520797-36520882)
chr2 (44-129)||(8234809-8234894)
chr2 (49-129)||(44187701-44187782)
chr2 (45-129)||(17154643-17154727)
chr2 (46-129)||(17239896-17239979)
chr2 (48-129)||(11133072-11133154)
chr2 (47-129)||(20122492-20122574)
chr2 (45-129)||(2114452-2114536)
chr2 (49-129)||(36665428-36665508)
chr2 (46-129)||(15392228-15392311)
chr2 (62-129)||(16028125-16028192)
chr2 (50-129)||(22297469-22297548)
chr2 (54-129)||(24034070-24034145)
chr2 (47-129)||(20533753-20533835)
chr2 (46-128)||(25050258-25050340)
chr2 (49-127)||(26807103-26807181)
chr2 (45-111)||(39726469-39726535)
chr2 (56-129)||(20208866-20208938)
chr2 (46-111)||(27495533-27495598)
chr2 (56-129)||(32891286-32891359)
chr2 (50-130)||(9802892-9802971)
chr2 (57-129)||(44721721-44721793)
chr2 (46-129)||(1836583-1836666)
chr2 (46-129)||(7086248-7086331)
chr2 (50-109)||(9791932-9791991)
chr2 (50-129)||(9796897-9796975)
chr2 (46-129)||(16973903-16973986)
chr2 (50-129)||(41699101-41699180)
chr2 (47-129)||(17115561-17115643)
chr2 (51-129)||(18007249-18007327)
chr2 (51-129)||(19052628-19052706)
chr2 (48-129)||(29034972-29035054)
chr2 (64-129)||(3364738-3364803)
chr2 (44-129)||(9547144-9547229)
chr2 (44-100)||(10207638-10207694)
chr2 (49-129)||(14307711-14307791)
chr2 (46-94)||(15690086-15690134)
chr2 (46-94)||(31564090-31564138)
chr2 (57-129)||(32943345-32943417)
chr2 (45-129)||(33001570-33001654)
chr2 (49-93)||(36481067-36481111)
chr2 (49-129)||(44422105-44422185)
chr2 (47-106)||(18364415-18364474)
chr2 (46-109)||(22538534-22538597)
chr2 (47-129)||(32527094-32527177)
chr2 (47-129)||(38530211-38530294)
chr2 (48-129)||(2304286-2304368)
chr2 (45-111)||(2558293-2558359)
chr2 (45-91)||(14879122-14879168)
chr2 (47-129)||(32988346-32988428)
chr2 (51-129)||(36426873-36426951)
chr2 (45-126)||(16261326-16261407)
chr2 (45-94)||(27875061-27875109)
chr2 (48-129)||(34107271-34107352)
chr2 (50-119)||(34620517-34620586)
chr2 (73-129)||(25731956-25732012)
chr2 (66-129)||(19905672-19905735)
chr2 (49-124)||(41711658-41711733)
chr2 (62-129)||(45523676-45523743)
chr2 (51-129)||(5029117-5029195)
chr2 (48-126)||(21874991-21875069)
chr2 (48-129)||(21970456-21970538)
chr2 (48-129)||(23405196-23405277)
chr2 (48-129)||(29664599-29664681)
chr2 (48-129)||(34034347-34034428)
chr2 (46-120)||(35049176-35049249)
chr2 (72-129)||(3037639-3037696)
chr2 (56-129)||(18386829-18386902)
chr2 (96-129)||(36190099-36190132)
chr2 (75-119)||(17974839-17974883)
chr2 (46-90)||(33956251-33956295)
chr2 (46-90)||(38402792-38402836)
chr2 (49-129)||(38820573-38820652)
chr2 (77-129)||(45314436-45314488)
[»] chr3 (86 HSPs)
chr3 (44-129)||(43566813-43566898)
chr3 (44-129)||(33206750-33206835)
chr3 (44-129)||(35483262-35483347)
chr3 (44-128)||(24751278-24751362)
chr3 (46-129)||(16006523-16006606)
chr3 (50-129)||(40786279-40786358)
chr3 (47-129)||(49146080-49146162)
chr3 (50-126)||(41121870-41121946)
chr3 (45-129)||(50724362-50724445)
chr3 (45-129)||(50788403-50788486)
chr3 (50-129)||(8475414-8475493)
chr3 (46-129)||(21420206-21420289)
chr3 (46-129)||(49639023-49639106)
chr3 (54-129)||(53467952-53468026)
chr3 (47-129)||(13539981-13540063)
chr3 (46-108)||(50720417-50720479)
chr3 (46-108)||(50792369-50792431)
chr3 (56-129)||(36727480-36727552)
chr3 (44-129)||(42271030-42271115)
chr3 (46-129)||(16277968-16278051)
chr3 (62-129)||(23820640-23820707)
chr3 (48-129)||(9624979-9625061)
chr3 (48-129)||(27183698-27183780)
chr3 (48-129)||(38555045-38555126)
chr3 (48-129)||(43774181-43774263)
chr3 (55-129)||(49019187-49019261)
chr3 (48-129)||(19137616-19137697)
chr3 (44-129)||(32508811-32508896)
chr3 (49-129)||(36331743-36331824)
chr3 (45-129)||(13616091-13616175)
chr3 (44-129)||(54983722-54983811)
chr3 (46-129)||(14417863-14417946)
chr3 (46-129)||(17439982-17440065)
chr3 (50-129)||(38176053-38176132)
chr3 (48-129)||(7448380-7448462)
chr3 (48-129)||(7456522-7456604)
chr3 (48-129)||(14868681-14868763)
chr3 (45-94)||(34503209-34503258)
chr3 (56-125)||(35849300-35849369)
chr3 (51-111)||(32876151-32876211)
chr3 (45-129)||(45713474-45713558)
chr3 (42-129)||(53472615-53472703)
chr3 (46-129)||(13874851-13874933)
chr3 (48-123)||(16874213-16874288)
chr3 (46-129)||(27066605-27066688)
chr3 (43-110)||(34136755-34136822)
chr3 (51-124)||(3784069-3784143)
chr3 (48-129)||(10959129-10959211)
chr3 (44-94)||(19540334-19540384)
chr3 (57-111)||(20244140-20244194)
chr3 (48-129)||(24559385-24559467)
chr3 (49-148)||(29507215-29507316)
chr3 (47-129)||(32665277-32665359)
chr3 (63-129)||(39492833-39492899)
chr3 (49-110)||(43598796-43598858)
chr3 (51-97)||(47427725-47427771)
chr3 (64-129)||(37279640-37279705)
chr3 (52-109)||(38682295-38682352)
chr3 (77-129)||(34407107-34407159)
chr3 (49-129)||(48173284-48173364)
chr3 (51-94)||(19117458-19117501)
chr3 (46-129)||(20623794-20623877)
chr3 (46-129)||(28206554-28206637)
chr3 (48-126)||(34898759-34898837)
chr3 (86-129)||(48347289-48347332)
chr3 (49-91)||(335085-335127)
chr3 (51-129)||(4045651-4045729)
chr3 (47-129)||(31917884-31917966)
chr3 (44-94)||(33072283-33072333)
chr3 (48-129)||(41767785-41767867)
chr3 (48-129)||(47191369-47191451)
chr3 (51-97)||(51399950-51399996)
chr3 (57-129)||(12711974-12712047)
chr3 (46-98)||(26366263-26366316)
chr3 (73-129)||(362965-363021)
chr3 (46-94)||(2564916-2564964)
chr3 (81-129)||(2995208-2995256)
chr3 (47-126)||(4860160-4860239)
chr3 (47-126)||(4880168-4880247)
chr3 (46-94)||(8958358-8958406)
chr3 (71-126)||(9114033-9114089)
chr3 (73-129)||(18020267-18020323)
chr3 (49-109)||(28693303-28693363)
chr3 (50-121)||(31576509-31576581)
chr3 (54-94)||(34344829-34344869)
chr3 (62-130)||(47062083-47062150)
[»] chr7 (77 HSPs)
chr7 (46-129)||(22965975-22966058)
chr7 (46-129)||(34948101-34948184)
chr7 (43-129)||(23685571-23685657)
chr7 (43-129)||(36315991-36316077)
chr7 (44-129)||(30644162-30644247)
chr7 (43-129)||(38778696-38778782)
chr7 (46-128)||(44437843-44437925)
chr7 (52-129)||(46716334-46716411)
chr7 (45-129)||(42887148-42887232)
chr7 (44-129)||(2366350-2366435)
chr7 (52-129)||(27047732-27047809)
chr7 (46-111)||(46337903-46337968)
chr7 (50-129)||(47552212-47552291)
chr7 (47-129)||(5787457-5787539)
chr7 (48-129)||(41417292-41417374)
chr7 (56-129)||(8724385-8724458)
chr7 (44-129)||(49012391-49012476)
chr7 (49-129)||(2261501-2261581)
chr7 (45-109)||(8195909-8195973)
chr7 (46-126)||(14967654-14967734)
chr7 (46-126)||(15397130-15397210)
chr7 (46-129)||(17900896-17900979)
chr7 (46-129)||(21086099-21086182)
chr7 (46-129)||(22706045-22706128)
chr7 (50-129)||(30152740-30152819)
chr7 (46-129)||(31694066-31694148)
chr7 (46-129)||(45198115-45198198)
chr7 (55-129)||(924309-924383)
chr7 (46-127)||(4818015-4818097)
chr7 (45-111)||(7263033-7263099)
chr7 (48-129)||(14818382-14818464)
chr7 (48-129)||(15265380-15265462)
chr7 (48-129)||(21285370-21285452)
chr7 (46-129)||(22741198-22741283)
chr7 (46-111)||(43970888-43970953)
chr7 (64-129)||(45011675-45011740)
chr7 (46-110)||(21925470-21925534)
chr7 (45-129)||(25711148-25711232)
chr7 (46-110)||(29778976-29779040)
chr7 (49-129)||(32814825-32814905)
chr7 (46-94)||(34962024-34962072)
chr7 (46-110)||(35919707-35919771)
chr7 (51-94)||(4590658-4590701)
chr7 (46-129)||(7908705-7908787)
chr7 (55-129)||(19126740-19126815)
chr7 (51-94)||(22047520-22047563)
chr7 (46-129)||(29710118-29710200)
chr7 (47-129)||(31475857-31475940)
chr7 (43-129)||(8725155-8725240)
chr7 (47-129)||(11808034-11808116)
chr7 (49-126)||(24188471-24188548)
chr7 (48-129)||(29658289-29658371)
chr7 (48-109)||(41139083-41139145)
chr7 (47-85)||(45197314-45197352)
chr7 (47-127)||(7465462-7465542)
chr7 (48-129)||(37917389-37917470)
chr7 (48-129)||(43635585-43635666)
chr7 (45-93)||(4104474-4104522)
chr7 (46-90)||(25087006-25087050)
chr7 (46-94)||(25818281-25818329)
chr7 (46-129)||(13905443-13905526)
chr7 (47-129)||(22660736-22660819)
chr7 (62-129)||(24396956-24397023)
chr7 (62-129)||(27907913-27907980)
chr7 (46-129)||(38025336-38025419)
chr7 (46-129)||(42260048-42260130)
chr7 (47-109)||(48082195-48082258)
chr7 (52-109)||(28735235-28735292)
chr7 (43-129)||(36176863-36176949)
chr7 (51-129)||(38792212-38792290)
chr7 (44-94)||(45417466-45417516)
chr7 (48-129)||(7392323-7392404)
chr7 (58-126)||(22590671-22590738)
chr7 (44-121)||(30741557-30741634)
chr7 (49-129)||(37410498-37410578)
chr7 (50-129)||(10474529-10474608)
chr7 (77-129)||(24579303-24579355)
[»] chr6 (66 HSPs)
chr6 (46-129)||(19642564-19642647)
chr6 (46-129)||(32057029-32057112)
chr6 (44-129)||(22389767-22389852)
chr6 (45-129)||(10377141-10377225)
chr6 (45-129)||(12089091-12089175)
chr6 (46-129)||(30566053-30566136)
chr6 (45-129)||(9491752-9491836)
chr6 (45-129)||(34365729-34365813)
chr6 (46-129)||(7563593-7563676)
chr6 (48-129)||(9064862-9064944)
chr6 (46-148)||(10373590-10373691)
chr6 (46-111)||(18244047-18244112)
chr6 (50-129)||(12127926-12128005)
chr6 (50-129)||(15288972-15289051)
chr6 (62-129)||(19165362-19165428)
chr6 (48-126)||(25064689-25064767)
chr6 (48-129)||(5134451-5134533)
chr6 (47-129)||(35190759-35190841)
chr6 (46-110)||(8233081-8233145)
chr6 (46-94)||(34396078-34396126)
chr6 (48-130)||(2945592-2945675)
chr6 (62-125)||(9438313-9438376)
chr6 (46-129)||(18631467-18631550)
chr6 (46-129)||(21507218-21507301)
chr6 (48-129)||(6143961-6144042)
chr6 (44-126)||(11982755-11982836)
chr6 (48-129)||(14981719-14981801)
chr6 (45-99)||(22501012-22501066)
chr6 (49-110)||(5288381-5288442)
chr6 (44-129)||(16269734-16269819)
chr6 (56-129)||(20716409-20716482)
chr6 (52-129)||(25020545-25020622)
chr6 (64-129)||(26528580-26528645)
chr6 (52-129)||(30833018-30833095)
chr6 (45-129)||(12291164-12291248)
chr6 (47-111)||(34792879-34792942)
chr6 (46-109)||(16801784-16801847)
chr6 (46-129)||(19417817-19417900)
chr6 (45-111)||(7303786-7303852)
chr6 (48-122)||(10455739-10455813)
chr6 (48-129)||(24256913-24256994)
chr6 (46-108)||(24623517-24623579)
chr6 (56-129)||(753329-753402)
chr6 (46-111)||(6025421-6025486)
chr6 (50-127)||(7392537-7392614)
chr6 (48-129)||(26669676-26669757)
chr6 (52-109)||(26878801-26878858)
chr6 (46-111)||(34521988-34522053)
chr6 (46-106)||(17419737-17419797)
chr6 (44-108)||(18991477-18991541)
chr6 (47-126)||(34432789-34432868)
chr6 (51-129)||(6530221-6530300)
chr6 (50-129)||(16251540-16251619)
chr6 (70-129)||(22983599-22983658)
chr6 (54-129)||(23771036-23771111)
chr6 (70-129)||(23804750-23804809)
chr6 (52-91)||(31741518-31741557)
chr6 (49-110)||(2044648-2044710)
chr6 (48-129)||(3448348-3448430)
chr6 (63-129)||(12101898-12101964)
chr6 (48-129)||(20568274-20568355)
chr6 (52-129)||(29284118-29284196)
chr6 (48-129)||(6219351-6219431)
chr6 (44-129)||(10424552-10424636)
chr6 (73-126)||(11636685-11636738)
chr6 (77-129)||(1488114-1488166)
[»] chr8 (83 HSPs)
chr8 (44-129)||(9524950-9525035)
chr8 (46-129)||(15042382-15042465)
chr8 (46-129)||(24608500-24608583)
chr8 (42-128)||(17980273-17980359)
chr8 (44-129)||(13762529-13762614)
chr8 (45-129)||(34073256-34073340)
chr8 (46-129)||(2376513-2376596)
chr8 (43-129)||(4798558-4798644)
chr8 (44-129)||(42688049-42688134)
chr8 (44-128)||(43847695-43847779)
chr8 (46-125)||(25119203-25119282)
chr8 (46-129)||(39484387-39484470)
chr8 (46-129)||(43468722-43468805)
chr8 (45-129)||(23857340-23857425)
chr8 (45-129)||(9737377-9737461)
chr8 (46-129)||(27558888-27558970)
chr8 (48-129)||(2800015-2800097)
chr8 (45-127)||(25689407-25689489)
chr8 (44-129)||(6064370-6064455)
chr8 (44-129)||(14010789-14010874)
chr8 (45-129)||(5184904-5184988)
chr8 (45-129)||(17987466-17987550)
chr8 (46-94)||(28465613-28465661)
chr8 (62-129)||(10199759-10199826)
chr8 (44-91)||(41225720-41225767)
chr8 (48-129)||(2696529-2696611)
chr8 (43-129)||(7649521-7649606)
chr8 (48-129)||(10292348-10292430)
chr8 (44-94)||(40249932-40249982)
chr8 (46-91)||(29108657-29108702)
chr8 (46-127)||(35556405-35556486)
chr8 (52-129)||(43874994-43875071)
chr8 (49-129)||(24074504-24074584)
chr8 (45-129)||(25139904-25139988)
chr8 (49-129)||(44136294-44136374)
chr8 (46-129)||(1032978-1033060)
chr8 (51-129)||(1588766-1588845)
chr8 (46-129)||(10970261-10970344)
chr8 (50-109)||(26703927-26703986)
chr8 (48-129)||(38790589-38790672)
chr8 (51-129)||(7540505-7540583)
chr8 (45-111)||(8682375-8682441)
chr8 (75-129)||(13702369-13702423)
chr8 (48-129)||(14012608-14012690)
chr8 (44-94)||(29514203-29514253)
chr8 (72-129)||(7314754-7314811)
chr8 (48-120)||(21133545-21133618)
chr8 (45-90)||(25689503-25689548)
chr8 (50-126)||(26192708-26192784)
chr8 (44-129)||(27822063-27822148)
chr8 (48-129)||(29937207-29937288)
chr8 (44-109)||(31373313-31373378)
chr8 (48-129)||(39432345-39432426)
chr8 (45-110)||(41089186-41089251)
chr8 (49-110)||(42761901-42761962)
chr8 (72-128)||(4293904-4293960)
chr8 (53-129)||(8740673-8740749)
chr8 (50-98)||(9578050-9578098)
chr8 (65-129)||(42762047-42762111)
chr8 (46-129)||(8034525-8034608)
chr8 (74-129)||(13537328-13537383)
chr8 (74-129)||(13626876-13626931)
chr8 (70-129)||(30942616-30942675)
chr8 (43-129)||(44923314-44923401)
chr8 (47-129)||(220379-220461)
chr8 (47-129)||(689534-689616)
chr8 (47-129)||(734002-734084)
chr8 (47-129)||(857898-857980)
chr8 (49-107)||(7603729-7603787)
chr8 (46-100)||(36467930-36467984)
chr8 (56-86)||(44360994-44361024)
chr8 (44-129)||(3379665-3379748)
chr8 (72-129)||(22426422-22426479)
chr8 (45-122)||(28378806-28378883)
chr8 (72-129)||(33570446-33570503)
chr8 (72-129)||(35301180-35301237)
chr8 (45-90)||(40329261-40329306)
chr8 (48-111)||(5323919-5323982)
chr8 (62-129)||(17110314-17110381)
chr8 (77-129)||(22847279-22847331)
chr8 (48-129)||(31129301-31129380)
chr8 (46-82)||(33566954-33566990)
chr8 (62-129)||(40329621-40329689)
[»] chr4 (100 HSPs)
chr4 (44-129)||(9924849-9924934)
chr4 (45-129)||(47017963-47018047)
chr4 (46-129)||(56546466-56546549)
chr4 (49-129)||(32885686-32885766)
chr4 (45-129)||(45350270-45350354)
chr4 (45-129)||(45359749-45359833)
chr4 (46-129)||(548904-548987)
chr4 (46-129)||(13211369-13211452)
chr4 (50-129)||(34773700-34773779)
chr4 (46-129)||(43115263-43115346)
chr4 (43-129)||(46734986-46735072)
chr4 (46-130)||(9285675-9285759)
chr4 (48-128)||(34106598-34106678)
chr4 (47-111)||(35909198-35909262)
chr4 (44-111)||(9172406-9172473)
chr4 (46-129)||(24234091-24234174)
chr4 (46-129)||(50657875-50657958)
chr4 (48-129)||(48968227-48968309)
chr4 (44-129)||(20753142-20753227)
chr4 (50-129)||(8690212-8690292)
chr4 (45-129)||(31601800-31601884)
chr4 (45-129)||(38433305-38433389)
chr4 (49-129)||(56314759-56314839)
chr4 (46-129)||(3465578-3465661)
chr4 (50-129)||(35031382-35031461)
chr4 (47-129)||(52031202-52031285)
chr4 (55-129)||(3442847-3442921)
chr4 (43-97)||(4722513-4722567)
chr4 (48-129)||(15640460-15640542)
chr4 (48-129)||(28520748-28520830)
chr4 (48-129)||(40150469-40150551)
chr4 (48-129)||(42411471-42411553)
chr4 (47-129)||(52560760-52560842)
chr4 (51-129)||(53697997-53698075)
chr4 (52-129)||(35747499-35747576)
chr4 (49-129)||(3544449-3544529)
chr4 (46-126)||(5430385-5430465)
chr4 (49-129)||(12856182-12856262)
chr4 (46-129)||(21476098-21476181)
chr4 (51-110)||(37728939-37728998)
chr4 (48-129)||(9692958-9693040)
chr4 (51-129)||(10098125-10098203)
chr4 (48-129)||(14149789-14149871)
chr4 (44-130)||(20181204-20181290)
chr4 (47-129)||(26253948-26254030)
chr4 (47-129)||(27921892-27921974)
chr4 (47-129)||(34684564-34684646)
chr4 (48-129)||(46799404-46799485)
chr4 (48-129)||(53815692-53815774)
chr4 (47-109)||(55266472-55266534)
chr4 (53-122)||(5635191-5635260)
chr4 (46-111)||(33944398-33944463)
chr4 (44-129)||(44074847-44074931)
chr4 (45-94)||(46482869-46482918)
chr4 (45-94)||(50783486-50783535)
chr4 (45-129)||(22751003-22751087)
chr4 (45-129)||(29269332-29269415)
chr4 (47-129)||(36954131-36954215)
chr4 (51-95)||(46937262-46937306)
chr4 (45-93)||(52743222-52743270)
chr4 (47-122)||(534789-534864)
chr4 (58-129)||(6481601-6481672)
chr4 (42-85)||(17859769-17859812)
chr4 (46-129)||(23661375-23661458)
chr4 (46-129)||(49089294-49089377)
chr4 (62-129)||(51077878-51077945)
chr4 (56-110)||(6053985-6054039)
chr4 (52-129)||(9084759-9084837)
chr4 (48-129)||(12820422-12820504)
chr4 (47-129)||(33076528-33076608)
chr4 (48-129)||(36008271-36008353)
chr4 (71-129)||(37032196-37032254)
chr4 (46-128)||(43606118-43606200)
chr4 (43-109)||(55345756-55345822)
chr4 (48-144)||(2565257-2565353)
chr4 (44-129)||(6637739-6637823)
chr4 (48-129)||(20166313-20166394)
chr4 (52-93)||(52608620-52608661)
chr4 (45-109)||(6710248-6710312)
chr4 (46-94)||(20266857-20266905)
chr4 (49-129)||(35803110-35803190)
chr4 (45-93)||(40200809-40200857)
chr4 (51-94)||(44374131-44374175)
chr4 (50-129)||(49319392-49319471)
chr4 (45-93)||(53291436-53291484)
chr4 (50-101)||(6365323-6365374)
chr4 (50-129)||(26203804-26203883)
chr4 (62-129)||(47416479-47416546)
chr4 (46-92)||(31578014-31578060)
chr4 (51-128)||(56531254-56531332)
chr4 (46-94)||(438430-438479)
chr4 (80-129)||(7768805-7768854)
chr4 (52-109)||(33536226-33536283)
chr4 (48-129)||(41492516-41492596)
chr4 (48-129)||(49743359-49743440)
chr4 (46-94)||(12868078-12868126)
chr4 (62-129)||(26708569-26708636)
chr4 (53-129)||(35230312-35230388)
chr4 (50-129)||(44272935-44273014)
chr4 (46-94)||(55656160-55656208)
[»] chr5 (74 HSPs)
chr5 (46-129)||(33800888-33800971)
chr5 (47-129)||(18872517-18872599)
chr5 (45-129)||(19059021-19059105)
chr5 (45-129)||(1244744-1244828)
chr5 (52-111)||(27440333-27440392)
chr5 (46-129)||(29106055-29106138)
chr5 (50-129)||(29841347-29841426)
chr5 (45-129)||(843385-843469)
chr5 (45-129)||(32158431-32158515)
chr5 (46-129)||(33729772-33729856)
chr5 (54-129)||(2411311-2411386)
chr5 (50-129)||(18478002-18478081)
chr5 (42-129)||(20945908-20945995)
chr5 (46-129)||(22599953-22600035)
chr5 (50-129)||(24205435-24205513)
chr5 (44-111)||(40339134-40339201)
chr5 (51-129)||(29096325-29096403)
chr5 (50-129)||(4674832-4674912)
chr5 (51-129)||(1463870-1463949)
chr5 (46-129)||(2029145-2029228)
chr5 (46-109)||(4666483-4666546)
chr5 (47-129)||(6447497-6447580)
chr5 (46-129)||(6614055-6614138)
chr5 (62-129)||(7234889-7234956)
chr5 (47-98)||(7645150-7645201)
chr5 (46-129)||(8015830-8015913)
chr5 (46-129)||(27219580-27219663)
chr5 (62-129)||(29144153-29144220)
chr5 (46-129)||(29266063-29266146)
chr5 (47-129)||(36045151-36045234)
chr5 (48-129)||(37303930-37304012)
chr5 (46-123)||(29050795-29050872)
chr5 (45-129)||(10508574-10508658)
chr5 (45-129)||(13754000-13754084)
chr5 (49-129)||(14487559-14487639)
chr5 (49-129)||(26302511-26302590)
chr5 (49-109)||(31934912-31934972)
chr5 (46-94)||(36888145-36888193)
chr5 (57-129)||(42455411-42455483)
chr5 (45-129)||(42595735-42595819)
chr5 (44-111)||(9577295-9577362)
chr5 (46-129)||(21017623-21017706)
chr5 (50-129)||(23925542-23925621)
chr5 (64-130)||(972992-973058)
chr5 (48-129)||(6806657-6806739)
chr5 (48-129)||(7147036-7147117)
chr5 (48-100)||(4793965-4794018)
chr5 (52-93)||(22863770-22863811)
chr5 (49-110)||(23648328-23648388)
chr5 (49-110)||(23810184-23810244)
chr5 (48-129)||(25660909-25660990)
chr5 (50-111)||(34010534-34010595)
chr5 (46-94)||(9176838-9176886)
chr5 (45-129)||(20699443-20699526)
chr5 (42-129)||(27025446-27025534)
chr5 (88-128)||(37684536-37684576)
chr5 (46-94)||(43404377-43404425)
chr5 (48-126)||(4067982-4068060)
chr5 (46-93)||(29329018-29329065)
chr5 (50-129)||(30403749-30403828)
chr5 (47-129)||(42618430-42618513)
chr5 (75-129)||(10943740-10943794)
chr5 (48-129)||(20735192-20735274)
chr5 (43-93)||(42070604-42070654)
chr5 (48-129)||(3535953-3536034)
chr5 (64-129)||(15978694-15978759)
chr5 (49-129)||(20186864-20186942)
chr5 (44-129)||(24653136-24653220)
chr5 (62-111)||(26169047-26169096)
chr5 (51-96)||(30394569-30394614)
chr5 (70-111)||(33141824-33141865)
chr5 (49-129)||(11246511-11246591)
chr5 (45-129)||(29629962-29630046)
chr5 (88-128)||(37553915-37553955)
[»] scaffold1086 (1 HSPs)
scaffold1086 (46-129)||(2483-2566)
[»] scaffold0178 (1 HSPs)
scaffold0178 (50-129)||(4322-4401)
[»] scaffold0039 (1 HSPs)
scaffold0039 (46-129)||(101826-101909)
[»] scaffold0765 (1 HSPs)
scaffold0765 (45-129)||(738-822)
[»] scaffold0191 (1 HSPs)
scaffold0191 (53-129)||(16849-16924)
[»] scaffold0009 (1 HSPs)
scaffold0009 (46-129)||(185529-185612)
[»] scaffold1990 (1 HSPs)
scaffold1990 (51-129)||(894-972)
[»] scaffold0308 (1 HSPs)
scaffold0308 (48-129)||(7072-7154)
[»] scaffold0092 (1 HSPs)
scaffold0092 (51-129)||(47334-47412)
[»] scaffold0036 (1 HSPs)
scaffold0036 (48-129)||(25022-25104)
[»] scaffold0334 (1 HSPs)
scaffold0334 (44-129)||(5297-5381)
[»] scaffold0008 (1 HSPs)
scaffold0008 (51-94)||(43748-43791)
[»] scaffold0809 (1 HSPs)
scaffold0809 (48-129)||(4823-4904)
[»] scaffold0262 (1 HSPs)
scaffold0262 (87-129)||(2577-2619)
[»] scaffold0112 (1 HSPs)
scaffold0112 (48-129)||(17948-18030)
[»] scaffold0006 (1 HSPs)
scaffold0006 (46-112)||(159009-159075)
[»] scaffold0533 (1 HSPs)
scaffold0533 (56-109)||(9331-9384)
[»] scaffold0119 (1 HSPs)
scaffold0119 (48-129)||(1036-1117)
[»] scaffold0024 (1 HSPs)
scaffold0024 (50-111)||(41801-41862)
[»] scaffold0070 (1 HSPs)
scaffold0070 (51-129)||(12564-12643)
[»] scaffold0021 (1 HSPs)
scaffold0021 (46-93)||(108983-109030)
[»] scaffold0062 (1 HSPs)
scaffold0062 (50-111)||(7053-7114)


Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 83)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 30 - 199
Target Start/End: Original strand, 11067418 - 11067587
Alignment:
30 ataaagtcaggtcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||||||||||||||||||||  | ||||||||||||| |||||||||||||||||  | ||||||||||||||| |||||||||||||||    
11067418 ataaagttaggtcattgtcccgtgagcataacttagttggtaggacagtgcattataatatgcaggagccgaggttcgaaccgcggacaccccacttatt 11067517  T
130 agccactaggctacctgacctaagnnnnnnnngtcgcgtcattattattttatcattaaagttgttagtg 199  Q
    |||||||||||||||||||| ||          |||||||||||||||||||||||||||||||||||||    
11067518 agccactaggctacctgaccaaaaaaaaaaaaatcgcgtcattattattttatcattaaagttgttagtg 11067587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 21884570 - 21884653
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| ||| |||||||||||||||||||| |||||||| || ||||||||||||| |||||||||||||||||    
21884570 gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttatt 21884653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 23930645 - 23930561
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||   ||||||||| |||||    
23930645 tgtcccgtgagcatagttcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccctggacaccccatttatt 23930561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 49251496 - 49251412
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||  |||||||||||||||||||||||| |||||||| ||||| |||||||||| |||||||||||||||||    
49251496 tgtcctgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttatt 49251412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 43 - 126
Target Start/End: Complemental strand, 23464089 - 23464006
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||| |||||||||||||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||    
23464089 attgtcccatgagcatagttcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt 23464006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 15774415 - 15774329
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||  |||||||||||||||||||||||| ||||| || ||||| |||||||||| | |||||||||||||||    
15774415 attgtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttatt 15774329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 4354208 - 4354122
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| |||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||  | |||||||||||||||    
4354208 attgtcctgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacttcggacaccccacttatt 4354122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 46 - 148
Target Start/End: Original strand, 43092148 - 43092250
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttattagccactaggctacct 145  Q
    ||||| ||||||||  ||| ||||||||| ||| |||||| |||||||| ||||| |||||||||| | ||||||| |||||||||||||||||||| ||    
43092148 gtcccatgagcataactcaattggtaggataatacattattatatgcaggggtcggggttcgaacctcggacacccaacttattagccactaggctatct 43092247  T
146 gac 148  Q
    |||    
43092248 gac 43092250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 538430 - 538346
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||||||| |||||||||||| |||||||| || ||  ||||||||| |  ||||||||||||||    
538430 tgtcccgtgagcatagttcagttggtagaacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttatt 538346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 18923986 - 18923902
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||||||||||||||||| |||||||| | ||  |||||||||| | |||||||||| ||||    
18923986 tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcagggttcagggttcgaacctcggacaccccacgtatt 18923902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 38020048 - 38019964
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcg-aaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||| || ||  ||||| |||| |||||||||||||||||    
38020048 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaaccccagacaccccacttatt 38019964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 39433352 - 39433436
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| |||||||||||||||||||| || |||||||||| |||||||| || ||| ||||||||| | |||||||||||||||    
39433352 tgtcccatgagcatagttcagttggtatgaaaatgcattattatatgcaggggccgatgttcgaacctcggacaccccacttatt 39433436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 24661977 - 24662060
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| ||| |||||||||||||||||||| |||||||| ||||  | |||||||| ||||||||||| |||||    
24661977 gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggtcaggattcgaaccccagacaccccatttatt 24662060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 27745149 - 27745235
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||| ||| ||||||||| |||||||||| |||||||| | ||| |||||||||| | ||||||||| |||||    
27745149 attgtcccgtgagcatagctcatttggtaggaaaatgcattattatatgcagggatcggggttcgaaccccggacaccccatttatt 27745235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29491466 - 29491548
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| ||||| |||||||||| | |||||||||||||||    
29491466 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt 29491548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 37733755 - 37733833
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
37733755 gtgaacatagctcagttggtaggacaatgcattattatatgcagtggacggggttcgaaccccggacaccccacttatt 37733833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 39238712 - 39238794
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || ||||||||||||| | |||||||||||||||    
39238712 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttatt 39238794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 37490883 - 37490968
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||  |||||||||||||||||||||||| |||||||| || || ||| |||||| | |||||||| ||||||    
37490883 ttgtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccggggtacgaaccacggacaccccgcttatt 37490968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 30649087 - 30649171
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| || ||||||| |||||||| ||||||| ||||||||  || | |||||||||| |||||||||||||||||    
30649087 tgtcccgtgagcaaagctcagttgataggacaacgcattattatatgcaggagttggggttcgaaccccagacaccccacttatt 30649171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 42831941 - 42832025
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||||||||||||||| |||||||| |||||||| ||  | ||||| |||| | |||||||||||||||    
42831941 tgtcccgtgagcatagctcagttggtaggacattgcattattatatgcaggggctggggttcaaaccccggacaccccacttatt 42832025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 43555975 - 43555891
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||||| |||||||||||||||||||||||| |||||||| | ||| ||||| ||||   |||||||||||||||    
43555975 tgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcagggatcggggttcaaacccaggacaccccacttatt 43555891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 46116275 - 46116191
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| | |||||||||||||||||||||| |||||||| ||  | |||||||||| | ||||||||| |||||    
46116275 tgtcccgtgagcatagcttagttggtaggacaatgcattatcatatgcaggggctggggttcgaaccccggacaccccaattatt 46116191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 3533073 - 3532991
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||| ||||||||||||||||| ||||| || ||||| ||||| |||| | |||||||||||||||    
3533073 gtcccgtgagcatagctcagttagtaggacaatgcattattatatgtaggggtcg-ggttccaaccccggacaccccacttatt 3532991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 45 - 128
Target Start/End: Complemental strand, 9408715 - 9408632
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    |||||||||||||||| |||||||||||||||||||||||| | |||||| |||||  ||||||| | | |||| |||||||||    
9408715 tgtcccgtgagcatagctcagttggtaggacaatgcattattaaatgcaggggtcggagttcgaatcccggacaacccacttat 9408632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 15368816 - 15368883
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
15368816 tcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 15368883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 4429579 - 4429517
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||| |||||||||||||||||||||||| |||||||| ||| | ||||||||||    
4429579 ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggttggggttcgaacc 4429517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 128
Target Start/End: Complemental strand, 2052781 - 2052700
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||    
2052781 cccgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttat 2052700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 41833633 - 41833552
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcaga-ggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||| ||||||||||||| ||||| ||| ||||| |||||||||| |  ||||||||||||||    
41833633 ccgtgagcatagttcaattggtatgacaatgcattattatatgtagagggtcggggttcgaaccccgaacaccccacttatt 41833552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 5172706 - 5172654
Alignment:
42 cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||||||| ||||||| |||||||||||||||| ||||||||    
5172706 cattgtcccgtgagcatagctcagttgataggacaatgcattattatatgcag 5172654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 121
Target Start/End: Complemental strand, 8261772 - 8261700
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccc 121  Q
    |||||||||||| ||||||||||||| |||||||||| |||||||| ||||| ||||| || | |||||||||    
8261772 ccgtgagcatagctcagttggtaggataatgcattattatatgcaggggtcggggttccaatcccagacaccc 8261700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 17056961 - 17056897
Alignment:
65 gttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||| |||||||| || || |||||||||| ||||| |||||||||||    
17056961 gttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacgccccacttatt 17056897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 39434612 - 39434696
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| |||||||||||||||||||| ||||||||||| | ||||| ||  | ||| ||||||||| | |||||||||||||||    
39434612 tgtcccatgagcatagttcagttggtatgacaatgcattgttatatgtaggagccgatgttcgaacctcggacaccccacttatt 39434696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 122
Target Start/End: Complemental strand, 40814866 - 40814790
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc 122  Q
    ||||||||||||||| |||||| ||| ||||||||||||| |||||||| ||||| |||||||| | | ||||||||    
40814866 gtcccgtgagcatagctcagttagtaagacaatgcattattatatgcaggggtcggggttcgaaacccggacacccc 40814790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 2208718 - 2208655
Alignment:
66 ttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||| |||||||| || |||||||| |||| |||||| ||||||||||    
2208718 ttggtaggacaatgcattattatatgcaggggacgaggttcaaaccccagacatcccacttatt 2208655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 40 - 129
Target Start/End: Original strand, 38021239 - 38021330
Alignment:
40 gtcattgtccc-gtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||| |||||||| | |||||||||||||| |||||||| || ||  ||||||||| | |||||||||||||||    
38021239 gtcattgtccccgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttatt 38021330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 109
Target Start/End: Original strand, 49916435 - 49916498
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||||||| ||| |||||||||||||||||||| ||||| || ||||| ||||||||    
49916435 gtcccgtgagcatagatcaattggtaggacaatgcattattatatgtaggggtcggggttcgaa 49916498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 17350057 - 17350139
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| |||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
17350057 cccgtgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 17350139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 19793526 - 19793604
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||  |||||||||||||||||||||||| |||||||| || ||   |||||||| | |||||||||||||||    
19793526 gtgagcataactcagttggtaggacaatgcattattatatgcaggggccggaattcgaaccccggacaccccacttatt 19793604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 40 - 94
Target Start/End: Complemental strand, 29331270 - 29331216
Alignment:
40 gtcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||| |||||||||||||||| | |||||||||||||||||||||| ||||||||    
29331270 gtcagtgtcccgtgagcatagcttagttggtaggacaatgcattattatatgcag 29331216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 34560440 - 34560355
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||  ||| ||||||||||||| |||||||||| ||||| |  |||| ||||||||||| | |||||||||||||||    
34560440 attgtcccgtgagtttagctcagttggtaggataatgcattattatatgtatgggtc-aggttcgaacctcggacaccccacttatt 34560355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 40678819 - 40678901
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || ||||||| || | |||||||||||||||    
40678819 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttatt 40678901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 43837500 - 43837418
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| ||||||||||||| |||||||| |  ||||||| ||||| ||||||||||   ||||||||| |||||    
43837500 tcccgtgagcatagctcagttggtaggaaaatgcattcttctatgcaggggtcggggttcgaaccctggacaccccatttatt 43837418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 48110525 - 48110607
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||| ||||||||||| |||||||||||| |||||||| ||| |  ||||||||| | |||||| ||||||||    
48110525 tcccgtgagcgtagctcagttggtagaacaatgcattattatatgcaggggttggagttcgaacctcggacacctcacttatt 48110607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 9768907 - 9768826
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||   ||||||| | |||||||| ||||| |||||||||| | |||||||||||||||    
9768907 cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt 9768826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 20357455 - 20357520
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||||| ||  | ||||||||||    
20357455 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggctggggttcgaacc 20357520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 20562500 - 20562435
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||||| ||  | ||||||||||    
20562500 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggctggggttcgaacc 20562435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 129
Target Start/End: Complemental strand, 16110109 - 16110037
Alignment:
57 atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||| |||||||||||||||| |||||||| ||| |||||||||||| || | || |||||||||    
16110109 atagctcagttgataggacaatgcattattatatgcaggggttgaggttcgaaccccaaagactccacttatt 16110037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 24168676 - 24168596
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||||| ||||||  ||||||||| ||||| || |  || |||||||||| |||||||||||||||||    
24168676 ccgtgagcatagctcagtttgtaggaacatgcattattatatgtagggaccggggttcgaaccccagacaccccacttatt 24168596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 49010805 - 49010753
Alignment:
41 tcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    |||| ||||||||||||||| |||||||||||||||||| ||||| |||||||    
49010805 tcatcgtcccgtgagcatagctcagttggtaggacaatgtattattatatgca 49010753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 17064351 - 17064284
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| | |||||||||||| ||||| ||| || |||||||||||| | |||||||||||||||    
17064351 tcagttggttgtacaatgcattattatatgtagaagttgaggttcgaaccactgacaccccacttatt 17064284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 91
Target Start/End: Complemental strand, 29442065 - 29442022
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatg 91  Q
    ||||||||||||| |||||||||||||||||||||||| |||||    
29442065 cccgtgagcatagctcagttggtaggacaatgcattattatatg 29442022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 32711223 - 32711161
Alignment:
66 ttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| |||||||||||| |||||||| || || |||||||||| |||||||||||||||||    
32711223 ttggtagaacaatgcattattatatgcag-ggccggggttcgaaccccagacaccccacttatt 32711161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 43237784 - 43237851
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||||||||||||| |||||||| ||||   ||||||||| ||||||||||| |||||    
43237784 tcagctggtaggacaatgcattattatatgcaggggtcagagttcgaaccacagacaccccagttatt 43237851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 47763485 - 47763402
Alignment:
47 tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||| ||| |||||||||||| |||||||| || ||  ||||||||| | |||| ||||||||||    
47763485 tcccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccacttatt 47763402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 49606798 - 49606715
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||||| ||||||| |||||||||||||||| ||||| || || ||  ||||||||  | |||||||||||||||    
49606798 gtcccgtaagcatagctcagttgttaggacaatgcattattatatgtaggggccggagttcgaacttcggacaccccacttatt 49606715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9527422 - 9527504
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||| | |||||||| ||||| |||| |||||   |||||||||||||||    
9527422 cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttatt 9527504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 35111646 - 35111727
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||| |||| |||||||||||| |||||||| || || |||||||||| |  ||||||||||||||    
35111646 cccgtgagcatagctcagttgataggaacaatgcattattatatgcag-gggcggggttcgaacccctaacaccccacttatt 35111727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 11405477 - 11405534
Alignment:
72 ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| | |||||||| ||||| |||||||||| | |||||||||||||||    
11405477 ggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt 11405534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 126
Target Start/End: Original strand, 38851633 - 38851710
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||| |||| |||||||||||||||||||||||| ||||| ||  |||| ||||| || | |||||||| |||||    
38851633 ccgtgagaatagctcagttggtaggacaatgcattattatatgtaggtgtcggggttcaaatcccagacacctcactt 38851710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 749683 - 749604
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||  ||||||||| | |||||||||||| ||||| || ||| | |||||||||| | |||||||||||||||    
749683 ccgtgagcataactcagttggtcgaacaatgcattattatatgtaggggttggggttcgaacc-ccgacaccccacttatt 749604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 129
Target Start/End: Original strand, 21635563 - 21635635
Alignment:
57 atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||| |||||| ||||||||||||  ||||||||| |||| ||||| |||| ||||||||||| |||||    
21635563 atagctcaattggtaagacaatgcattaatatatgcagatgtcggggttcaaaccccagacaccccagttatt 21635635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 22346412 - 22346479
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||| |||||||||||| | ||||||||||||||| |||||| ||| |||| ||||| ||||||||||    
22346412 attgtgccgtgagcatagctaagttggtaggacaatacattattataagcaggggtcg-ggttcgaacc 22346479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 11213549 - 11213466
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||| ||||| ||||||||||  ||||| |||||| ||||| |||||| |  ||||||||| | |||||||||||||||    
11213549 gtcctgtgaacatagctcagttggtaaaacaatacattattatatgtagaggttggagttcgaaccccggacaccccacttatt 11213466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 124
Target Start/End: Complemental strand, 11907403 - 11907324
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccac 124  Q
    |||||||||||||||  | | || || |||||||||||||| ||||||||||| || |||||||||| |  |||||||||    
11907403 tgtcccgtgagcataacttaattagttggacaatgcattattatatgcagaggccggggttcgaaccccgaacaccccac 11907324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 13870177 - 13870098
Alignment:
51 gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| |||||||| ||| |||||||||||| |||||||| || || |||| ||| | | |||||||||||||||    
13870177 gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccacttatt 13870098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 1721140 - 1721218
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| |||||||||||||  ||||||| | |||||||| || || | |||||||| | |||||| ||||||||    
1721140 gtgagcatagctcagttggtaggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacctcacttatt 1721218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 2643913 - 2643832
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| | |||||| || |||| |||||||| |||||||  ||||| |||| ||||| |||||||||||||||||    
2643913 cccgtgagcatagcttagttggcagagaca-tgcattattatatgcatgggtcggggtttgaaccccagacaccccacttatt 2643832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 9410425 - 9410345
Alignment:
48 cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| | ||||| |||||  | |||||||| ||| ||| |||||||| |||||||||||||||||    
9410425 cccgtgagcatagttcagttggcaaggaca-tgcatagttatatgcag-ggttgagattcgaacctcagacaccccacttatt 9410345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 25819181 - 25819263
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| ||||| ||  | || |||||||||| | || ||||||||||||    
25819181 cccgtgagcatagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccacttatt 25819263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 95
Target Start/End: Complemental strand, 33059597 - 33059543
Alignment:
41 tcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcaga 95  Q
    |||| |||| |||| ||||| ||||||||||||| |||||||||| |||||||||    
33059597 tcatagtcctgtgaacatagctcagttggtaggataatgcattattatatgcaga 33059543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 5680707 - 5680772
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||| || ||| ||||||||||| || |||||||||| ||||| || ||||| ||||||||||    
5680707 gtcccgtaagtataattcagttggtaagataatgcattattatatgtaggggtcggggttcgaacc 5680772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7906424 - 7906343
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||||||||   ||||||| | |||||||| ||  | ||||||||||   |||||||| ||||||    
7906424 cccgtgagcatagttcagttggtagggacatgcattgttatatgcaggggctggggttcgaacccgggacaccccgcttatt 7906343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 11802104 - 11802055
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||||||||||||||| ||||| || ||| | ||||||||||    
11802104 tcagttggtaggacaatgcattattatatgtaggggttggggttcgaacc 11802055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 12073182 - 12073133
Alignment:
41 tcattgtcccgtgagcatagttcagttggtaggacaatgcattataatat 90  Q
    |||| ||||||||||||||  ||||||||||||| |||||||||| ||||    
12073182 tcatggtcccgtgagcataactcagttggtaggataatgcattattatat 12073133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 12553191 - 12553272
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc-gaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| || |||||||||||||  ||||||| | |||||||| || | | |||||||||| | |||||||||||||||    
12553191 ccgtgagcacagctcagttggtaggaacatgcattgttatatgcaggggccgggggttcgaaccccggacaccccacttatt 12553272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 12866117 - 12866202
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcaga-ggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||| ||  ||||||||| |||||||||| ||||||||| || || |||||||| | || |||||| |||||||    
12866117 tgtcctgtgagcatagctcgattggtaggataatgcattattatatgcagagggccggggttcgaatcccacacaccctacttatt 12866202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 77 - 126
Target Start/End: Original strand, 42801905 - 42801954
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||| | |||||||||||| | |||||||||| ||||||||||||||    
42801905 atgcattgttatatgcagaggttggggttcgaaccccagacaccccactt 42801954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 2903096 - 2903044
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| | |||||||||||||| |||||||||| |  ||||||||||||||    
2903096 atgcattgttatatgcagaggtcggggttcgaaccccgaacaccccacttatt 2903044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 129
Target Start/End: Original strand, 4616903 - 4616951
Alignment:
81 attataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||| || ||||| |||||||||| |||||||||||||||||    
4616903 attattatatgtaggggtcgcggttcgaaccacagacaccccacttatt 4616951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 11238097 - 11238045
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||||| ||||| |||||||| | | |||||||||||||||    
11238097 atgcattattatatgcaggggtcggggttcgaatcccggacaccccacttatt 11238045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 85
Target Start/End: Original strand, 23990329 - 23990365
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattat 85  Q
    |||||||||||| |||||||||| |||||||||||||    
23990329 ccgtgagcatagctcagttggtaagacaatgcattat 23990365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 24014704 - 24014660
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||| |||| |||||||||| ||||||||||||| ||||||||    
24014704 cgtgagtatagctcagttggtaagacaatgcattattatatgcag 24014660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 52833207 - 52833123
Alignment:
46 gtcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||  |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||| |||| |||||    
52833207 gtcccgtgagcctaactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttatt 52833123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 66; Significance: 2e-29; HSPs: 78)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 30474297 - 30474212
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||||||| || ||||||||||||| |||||||||||||||||    
30474297 ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttatt 30474212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 3179316 - 3179402
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||  ||||||||||| |||||||||||| |||||||| |||||||||||||||| |||||||||||||||||    
3179316 attgtcccgtgagcataactcagttggtagaacaatgcattattatatgcaggggtcgaggttcgaacctcagacaccccacttatt 3179402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 10262734 - 10262817
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||||| ||||| |||||||||| |||||||||||||||||    
10262734 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttatt 10262817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 580884 - 580800
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
580884 tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 580800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 36520882 - 36520797
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| |||||||||||||||||||||||| ||||| || ||||| |||||||||| | |||||||||||||||    
36520882 ttgtcccgtgagcgtagctcagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttatt 36520797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 8234894 - 8234809
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| ||||||||||||||||| |||||| ||||| || || || |||||||||| | |||||||||||||||    
8234894 ttgtcccgtgagcatagctcagttggtaggacaatacattattatatgtaggggccggggttcgaaccccggacaccccacttatt 8234809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 44187701 - 44187782
Alignment:
49 ccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||| ||| | |||||||||| |||||||| ||||| |||||||||| |||||||||||||||||    
44187701 ccgtgagcatagttcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttatt 44187782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 17154643 - 17154727
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||  || ||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
17154643 tgtcccgtgagcataactcggttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 17154727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 17239896 - 17239979
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||||| ||||||||||| |||||||||||| |||||||| ||||| | |||||||| | |||||||||||||||    
17239896 gtcccatgagcatagctcagttggtagaacaatgcattattatatgcaggggtcgggattcgaacctcggacaccccacttatt 17239979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 11133072 - 11133154
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||||||| |||||||||| | |||||||| ||||| |||||||||| | |||||||||||||||    
11133072 cccgtgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt 11133154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 20122574 - 20122492
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||||||||||||||||||| ||||| || || || |||||||||| | ||||| |||||||||    
20122574 tcccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacacgccacttatt 20122492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 2114536 - 2114452
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||||||||||| |||||||||||| ||||| || ||||| |||||||||| | |||||| || |||||    
2114536 tgtcccgtgagcatagctcagttggtagaacaatgcattattatatgtaggggtcggggttcgaaccccggacacctcatttatt 2114452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 36665428 - 36665508
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| |||| |||||| ||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
36665428 ccgtgagtatagctcagtttgtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt 36665508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 15392311 - 15392228
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  |||||||||||||||||||||||| ||||| ||  | ||||||||||||| | |||||| ||||||||    
15392311 gtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggagacgaggttcgaacctcggacacctcacttatt 15392228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 16028192 - 16028125
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||| |||||||| ||||| |||||||||  |||||| ||||||||||    
16028192 tcagttggtaggacaatgcattattatatgcagtggtcggggttcgaactccagacatcccacttatt 16028125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 22297548 - 22297469
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| |||||||| ||  | |||||||||| | ||||||||| |||||    
22297548 cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggcaggggttcgaaccccggacaccccatttatt 22297469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 129
Target Start/End: Complemental strand, 24034145 - 24034070
Alignment:
54 agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| | |||||||||||||||||||||| |||||||| ||||| |||||||||| | ||||| |||||||||    
24034145 agcatagcttagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcggacactccacttatt 24034070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 20533753 - 20533835
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||| ||||||||||| ||||  |||||| |||||||||| |||||||||||||| || ||| ||||||||||    
20533753 tcccatgagcatagctcagttggtagaacaaaacattattatatgcagagatcgaggttcgaaccccacacatcccacttatt 20533835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 46 - 128
Target Start/End: Complemental strand, 25050340 - 25050258
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    |||| |||||||||| ||||||||||||| |||||||||| |||||||| ||||| | |||||||| ||||||| | ||||||    
25050340 gtccagtgagcatagctcagttggtaggataatgcattattatatgcaggggtcgggattcgaaccccagacacacaacttat 25050258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 127
Target Start/End: Complemental strand, 26807181 - 26807103
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta 127  Q
    |||||||||||  |||||||||||||||||||||||| |||||||| || |  |||||||||| ||| |||||||||||    
26807181 ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccagggttcgaaccccaggcaccccactta 26807103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 39726535 - 39726469
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||  ||| |||||||||||||||||||||||| ||||| || ||||||||||||||||    
39726535 tgtcccgtgagtctagctcagttggtaggacaatgcattattatatgtaggggtcgaggttcgaacc 39726469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 56 - 129
Target Start/End: Original strand, 20208866 - 20208938
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||| ||||||||||||| |||| ||||||| |||||||||||| ||||| |||||||||||    
20208866 catagctcagttggtaagacaatgcattattatatacagaggttgaggttcgaaccccagac-ccccacttatt 20208938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 27495533 - 27495598
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||| |||||| ||||||||||||||||||||||||| |||||||| ||| ||| ||||||||    
27495533 gtcccgtaagcataattcagttggtaggacaatgcattattatatgcaggggttgagattcgaacc 27495598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 56 - 129
Target Start/End: Original strand, 32891286 - 32891359
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||||||||||||||||| |||||||| |||||   |||||||| | |||||||||||||||    
32891286 catagctcagttggtaggacaatgcattattatatgcaggggtcggttttcgaaccccggacaccccacttatt 32891359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 130
Target Start/End: Original strand, 9802892 - 9802971
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta 130  Q
    ||||||||||| ||||||| | |||||||||||||| |||||||  ||||| |||||||||| | ||||||||||||||||    
9802892 cgtgagcatagctcagttgat-ggacaatgcattattatatgcaagggtcggggttcgaaccccggacaccccacttatta 9802971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 57 - 129
Target Start/End: Complemental strand, 44721793 - 44721721
Alignment:
57 atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||||| |||||||||||| |||||||| ||||| |||||||||| | ||||||||| |||||    
44721793 atagctcagttggtagaacaatgcattattatatgcaggggtcggggttcgaacctcggacaccccatttatt 44721721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 1836583 - 1836666
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||| |||||||||||||||||||||||| ||||| ||   ||| |||||||||| | ||||||| |||||||    
1836583 gtcccgtgagcctagctcagttggtaggacaatgcattattatatgaaggaatcggggttcgaaccccggacaccctacttatt 1836666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 7086248 - 7086331
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||| ||||||||||| |||||||| || || | |||||||| |  |||||||| |||||    
7086248 gtcccgtgagcatagctcagttggtagggcaatgcattattatatgcaggggccgggattcgaaccccgaacaccccaattatt 7086331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 109
Target Start/End: Complemental strand, 9791991 - 9791932
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||||||||||||||||||||||||||||||| ||||| ||  |||| ||||||||    
9791991 cgtgagcatagttcagttggtaggacaatgcattattatatgtaggtgtcggggttcgaa 9791932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 9796897 - 9796975
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||| ||||||| | |||||||||||||| |||||||| ||||| |||||||||| | |||||||||||||||    
9796897 cgtgaccatagctcagttgat-ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt 9796975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 16973903 - 16973986
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||| ||||||||||| ||||| |||||||| |||   | |||||||| | |||||||||||||||    
16973903 gtcccgtgagcatagctcagtttgtaggacaatggattattatatgcaggggttaggattcgaaccccggacaccccacttatt 16973986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 41699101 - 41699180
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||  ||||||||||||| | |||||||| |||||||| ||||| |||||||||| |  ||||||||||||||    
41699101 cgtgagcataactcagttggtaggatattgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttatt 41699180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 17115643 - 17115561
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| ||||||||||||||| || ||||| ||||||| ||||||  ||||||||| | |||| |||| |||||    
17115643 tcccgtgagcatagctcagttggtaggacactgtattattatatgcaaaggtcggagttcgaaccccggacatcccatttatt 17115561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 18007249 - 18007327
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||||||||||||||||| ||||| ||||| | |||| | ||||| |||| || ||||||||||||||    
18007249 gtgaacatagttcagttggtaggacaatgtattattatatgtaaaggttggggttcaaaccccatacaccccacttatt 18007327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 19052706 - 19052628
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||| |||||||||||||||||||| |||||||| ||||  | |||||||| | |||| ||||||||||    
19052706 gtgaacatagttcaattggtaggacaatgcattattatatgcaggggtcaggattcgaaccccggacatcccacttatt 19052628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29034972 - 29035054
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| |||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
29034972 cccgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 29035054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 129
Target Start/End: Original strand, 3364738 - 3364803
Alignment:
64 agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||| |||||||| || ||||||||||||   ||||||||||||||||    
3364738 agttggtaggacaatacattattatatgcaggggccgaggttcgaactttagacaccccacttatt 3364803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 9547229 - 9547144
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||||| ||||||| |||||||||| ||||| |||||||| || || |||||||| | |  ||||||||||||||    
9547229 ttgtcccgtgaacatagctcagttgataggacaatgtattattatatgcaggggccggggttcgaatcccgaacaccccacttatt 9547144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 100
Target Start/End: Original strand, 10207638 - 10207694
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcg 100  Q
    |||| |||||||||||| ||||||||||||| |||||||||| |||||||| |||||    
10207638 ttgttccgtgagcatagctcagttggtaggataatgcattattatatgcagtggtcg 10207694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 14307791 - 14307711
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| | ||||||||||||   ||||||| | |||||||| |||||||||||||||| |  ||||||||||||||    
14307791 ccgtgagcatggctcagttggtagggacatgcattgttatatgcaggggtcgaggttcgaaccccgaacaccccacttatt 14307711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 15690134 - 15690086
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||| |||||||||||||||||||||| | ||||||||    
15690134 gtcccgtgagcatagctcagttggtaggacaatgcattgttatatgcag 15690086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 31564090 - 31564138
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||  |||||||||||||||||||||||| ||||||||    
31564090 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcag 31564138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 129
Target Start/End: Original strand, 32943345 - 32943417
Alignment:
57 atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||||||||||||||||| |||||||||||  | ||||||||   | |||||||||||||||    
32943345 atagctcagttggtaggacaatgcattattatatgcagaggctggggttcgaatttcggacaccccacttatt 32943417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 33001654 - 33001570
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||  ||||||||||||||||||| |||| |||||||  || || |||| ||| | | |||||||||||||||    
33001654 tgtcccgtgagcataactcagttggtaggacaatgcgttattatatgcaagggccggggtttgaatcccggacaccccacttatt 33001570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 36481067 - 36481111
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    |||||||||||| |||||||||||||||||||||||| |||||||    
36481067 ccgtgagcatagctcagttggtaggacaatgcattattatatgca 36481111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 44422105 - 44422185
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| | | | |||||||||||||||||||| |||||||| | |||  ||||||||| | |||||||||||||||    
44422105 ccgtgagcatggcttatttggtaggacaatgcattattatatgcagggatcggagttcgaaccccggacaccccacttatt 44422185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 106
Target Start/End: Complemental strand, 18364474 - 18364415
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttc 106  Q
    |||||||||||||| | ||||||||| |||||||||||| |||||||| ||||| |||||    
18364474 tcccgtgagcatagctgagttggtagaacaatgcattattatatgcaggggtcggggttc 18364415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 109
Target Start/End: Original strand, 22538534 - 22538597
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||| ||  |||||||||||||||||||||||| |||||||| ||| | ||||||||    
22538534 gtcccgtgagcctaactcagttggtaggacaatgcattattatatgcaggggttggggttcgaa 22538597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 32527177 - 32527094
Alignment:
47 tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| | ||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| |||||| ||||||||||    
32527177 tcccgtaaacatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccacttatt 32527094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 38530294 - 38530211
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagagg-tcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||| ||| |||||||||||||||||||||||| |||| ||| || | | ||||||||| || |||||||||||||||    
38530294 tcccgtaagcttagctcagttggtaggacaatgcattattatatacaggggcttggggttcgaactgcggacaccccacttatt 38530211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 2304286 - 2304368
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||| |||||||| ||| |||||| ||||| ||||| || ||||| |||||||||| | |||||||||||||||    
2304286 cccgtgagcttagctcagttggcagggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccacttatt 2304368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 2558359 - 2558293
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||| |||| ||| |||||||||||||||||||| ||||| || ||||  ||||||||||    
2558359 tgtcccgtgagaatagctcaattggtaggacaatgcattattatatgtaggggtcagggttcgaacc 2558293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 91
Target Start/End: Original strand, 14879122 - 14879168
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatg 91  Q
    ||||||||||||||||||| |||||||||||||| |||||| |||||    
14879122 tgtcccgtgagcatagttccgttggtaggacaatacattattatatg 14879168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 32988346 - 32988428
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||||| ||||||||||||| ||| |||| ||  | |||||||||  |  ||||||||||||||    
32988346 tcccgtgagcatagctcagttggtaagacaatgcattattatacgcaggggctggggttcgaacatcgaacaccccacttatt 32988428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 36426951 - 36426873
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||| |||||||||||||||||||| ||||| || ||| | |||||||||  |  ||||||||||||||    
36426951 gtgagcatagctcacttggtaggacaatgcattattatatgtaggggttggggttcgaactccgaacaccccacttatt 36426873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 126
Target Start/End: Original strand, 16261326 - 16261407
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||| |||||||||| ||| ||||||| | |||||||| | |||||||| ||||   ||||||||| ||||||||||||||    
16261326 tgtcctgtgagcatagctcaattggtagtataatgcattgttatatgcaggggtcagagttcgaaccccagacaccccactt 16261407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 27875061 - 27875109
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||||||||||||||| |||||| |||||| ||||||||    
27875061 tgtcccgtgagcatagttcagttggta-gacaatccattatcatatgcag 27875109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 34107271 - 34107352
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||   ||| || || |||||||| ||| |||||||||||  |||||||||||||||||    
34107271 cccgtgagcatagctcagttggcagggacatgtataattatatgcaggggttgaggttcgaactccagacaccccacttatt 34107352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 119
Target Start/End: Original strand, 34620517 - 34620586
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacac 119  Q
    ||||||||||| || ||||||||||||||||||||| |||||||  ||| | |||| ||||| |||||||    
34620517 cgtgagcatagctcggttggtaggacaatgcattattatatgcaagggttggggtttgaaccccagacac 34620586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 129
Target Start/End: Original strand, 25731956 - 25732012
Alignment:
73 gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||||  ||||||||| | |||||||||||||||    
25731956 gacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttatt 25732012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 19905735 - 19905672
Alignment:
66 ttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||||||| |||| ||| ||||| |||||||||| | ||||||| |||||||    
19905735 ttggttggacaatgcattattatatacaggggtcggggttcgaaccccggacacccgacttatt 19905672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 124
Target Start/End: Complemental strand, 41711733 - 41711658
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccac 124  Q
    |||||||||||| || ||||||||||||||||||||| ||||| ||  ||||  ||| ||||| | ||||||||||    
41711733 ccgtgagcatagctctgttggtaggacaatgcattattatatgtaggagtcggtgtttgaaccccggacaccccac 41711658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 45523676 - 45523743
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||| || || |||||||| ||||| |||||||||| || ||||| ||| ||||    
45523676 tcagttggtaggacaatgtataattatatgcaggggtcggggttcgaaccccaaacacctcacctatt 45523743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 5029195 - 5029117
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||||||||||   ||||||||| ||||||||||| ||  ||||||| | |  ||||||||||||||    
5029195 gtgagcatagctcagttggtaggtatatgcattattatatgcagaggccggagttcgaatctcgaacaccccacttatt 5029117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 126
Target Start/End: Complemental strand, 21875069 - 21874991
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||||| |||||||||| |||  |||||| || |||||||| ||  ||||||||| || | ||||||||||||    
21875069 cccgtgagcataattcagttggtgggaacatgcataattatatgcaggggcagaggttcgatccccggacaccccactt 21874991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 21970538 - 21970456
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||  ||| |||||||||||| |||||||| | ||| |||||||||| | || ||||| ||||||    
21970538 cccgtgagcatagctcagttgacagggacaatgcattattatatgcagggatcggggttcgaaccccggataccccgcttatt 21970456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 23405196 - 23405277
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||| |||||||||||| ||| ||||| ||| ||||||| ||||| ||||||||||   |||||||||||||||    
23405196 cccgtgagcttagctcagttggtagggacattgcataata-tatgcaggggtcggggttcgaaccctggacaccccacttatt 23405277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29664599 - 29664681
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| |||| ||| |||||||||| | |||||||| ||||| ||||| || | | |||||||||||||||    
29664599 cccgtgagcatagctcaattggcagggacaatgcattgttatatgcaggggtcggggttcaaatcccggacaccccacttatt 29664681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 34034347 - 34034428
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| ||||| |||||| |||||||| |  || |||||||||| | |||||||||||||||    
34034347 cccgtgagcatagctcagttggcagggacaatacattattatatgcag-gaccggggttcgaaccccggacaccccacttatt 34034428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 120
Target Start/End: Complemental strand, 35049249 - 35049176
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacc 120  Q
    ||||| ||||||||  ||||||||||| |||||||||||| |||| || |||||| |||||||||| | ||||||    
35049249 gtcccatgagcataactcagttggtagaacaatgcattattatataca-aggtcggggttcgaacctcggacacc 35049176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 3037696 - 3037639
Alignment:
72 ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| | |||||||| || || |||||||||| | |||||||||||||||    
3037696 ggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttatt 3037639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 18386902 - 18386829
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||| |||||||||||||||||||| ||||| || ||  | |||||||||  | |||||||||||||||    
18386902 catagctcaattggtaggacaatgcattattatatgtaggggctggggttcgaactccggacaccccacttatt 18386829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 96 - 129
Target Start/End: Original strand, 36190099 - 36190132
Alignment:
96 ggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||||||||||    
36190099 ggtcgaggttcgaacctcagacaccccacttatt 36190132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 119
Target Start/End: Complemental strand, 17974883 - 17974839
Alignment:
75 caatgcattataatatgcagaggtcgaggttcgaaccgcagacac 119  Q
    ||||||||| | ||||||||||| ||||||||||||| |||||||    
17974883 caatgcattgttatatgcagaggccgaggttcgaaccccagacac 17974839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 33956251 - 33956295
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatat 90  Q
    ||||||||||||||  ||| |||||||||||||||||||| ||||    
33956251 gtcccgtgagcataactcaattggtaggacaatgcattattatat 33956295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 38402792 - 38402836
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatat 90  Q
    ||||||||||||||  || ||||||||||||||||||||| ||||    
38402792 gtcccgtgagcataactcggttggtaggacaatgcattattatat 38402836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 38820573 - 38820652
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||| ||||||| |||||||||||||||| ||||| || ||  | |||| ||||| ||||||||||| |||||    
38820573 ccgtgaacatagctcagttgttaggacaatgcattattatatgtaggggctggggtttgaacc-cagacaccccatttatt 38820652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Original strand, 45314436 - 45314488
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| | |||||||||||||| |||||||||  |||||| ||||||||||    
45314436 atgcattgttatatgcagaggtcggggttcgaacttcagacatcccacttatt 45314488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 86)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 43566898 - 43566813
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| |||||||||||||||||    
43566898 ttgtcccgtgaacatagctcagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcagacaccccacttatt 43566813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 33206750 - 33206835
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||||||| ||  | |||||||||| | |||||||||||||||    
33206750 ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttatt 33206835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 35483262 - 35483347
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||| ||||||||||||||||| |||||||| ||||| |||||||| | | |||||||||||||||    
35483262 ttgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttatt 35483347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 44 - 128
Target Start/End: Complemental strand, 24751362 - 24751278
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    ||||||||||||||||| |||||| ||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||    
24751362 ttgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat 24751278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 16006606 - 16006523
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  ||||||||||| ||||||||||||||||||||   |||| |||||||||| |||||||||||||||||    
16006606 gtcccgtgagcataactcagttggtagaacaatgcattataatatgcaagagtcggggttcgaaccccagacaccccacttatt 16006523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 40786279 - 40786358
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| |||||||  ||||| |||||||||| ||||| |||||||||||    
40786279 cgtgagcatagctcagttggtaggacaatgcattattatatgcatgggtcggggttcgaacctcagacgccccacttatt 40786358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 49146080 - 49146162
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||  |||||||||||||||||||||||| |||||||| ||||| |||||||||| | |||||||||||||||    
49146080 tcccgtgagcttaactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt 49146162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 50 - 126
Target Start/End: Original strand, 41121870 - 41121946
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||||||  |||||||||||||||||||||||| |||||||||||||| ||||| |||| | ||||||||||||    
41121870 cgtgagcataactcagttggtaggacaatgcattattatatgcagaggtcggggttcaaaccccggacaccccactt 41121946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 50724362 - 50724445
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||||||||| |||||||||||||| |||||||| ||| | |||||||||| | |||||||||||||||    
50724362 tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttatt 50724445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 50788486 - 50788403
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||||||||| |||||||||||||| |||||||| ||| | |||||||||| | |||||||||||||||    
50788486 tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttatt 50788403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 8475414 - 8475493
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| |||||||||||||| |||| ||| | |||||| || |||||||    
8475414 cgtgagcatagctcagttggtaggacaatgcattatgatatgcagaggtcggggtttgaatcccagacatccaacttatt 8475493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21420289 - 21420206
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||  ||| |||||||||||||||||||||||| |||||||| |||||||||||||| |   |||||||||||||||    
21420289 gtcccgtgagtttagctcagttggtaggacaatgcattattatatgcagcggtcgaggttcgaatcctggacaccccacttatt 21420206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 49639023 - 49639106
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| ||||| || || || |||||||||| |  ||||||||||||||    
49639023 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccgaacaccccacttatt 49639106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 54 - 129
Target Start/End: Original strand, 53467952 - 53468026
Alignment:
54 agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
53467952 agcatagttcagttggtaggacaatgcattattatatgcag-gggcggggttcgaacctcggacaccccacttatt 53468026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 13540063 - 13539981
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||| |||||||||||||||||||||||| ||||| || ||| | |||||||||| | |||||||||||||||    
13540063 tcccgtgagtatagctcagttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacaccccacttatt 13539981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 46 - 108
Target Start/End: Original strand, 50720417 - 50720479
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga 108  Q
    |||||||||||||||||||||||||||||||||||||||| ||||| |  |||||||||||||    
50720417 gtcccgtgagcatagttcagttggtaggacaatgcattattatatgtatgggtcgaggttcga 50720479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 46 - 108
Target Start/End: Complemental strand, 50792431 - 50792369
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga 108  Q
    |||||||||||||||||||||||||||||||||||||||| ||||| |  |||||||||||||    
50792431 gtcccgtgagcatagttcagttggtaggacaatgcattattatatgtatgggtcgaggttcga 50792369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 36727552 - 36727480
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||||||||||||||||| ||||||| |||||| |||||||||| | |||||||||||||||    
36727552 catagctcagttggtaggacaatgcattattatatgca-aggtcggggttcgaacctcggacaccccacttatt 36727480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 42271115 - 42271030
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||||||||||||||||||| | |||||||| || || |||||||||  | ||||||| |||||||    
42271115 ttgtcccgtgagcatagctcagttggtaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccctacttatt 42271030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 16278051 - 16277968
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||| ||||||||| |||||||| ||||| | |||||||  | |||| ||||||||||    
16278051 gtcccgtgagcatagctcagttggtaggaccatgcattattatatgcaggggtcgggattcgaactccggacatcccacttatt 16277968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 23820640 - 23820707
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||| |||||||| || ||  ||||||||| |||||||||||||||||    
23820640 tcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccagacaccccacttatt 23820707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9624979 - 9625061
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
9624979 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 9625061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 27183780 - 27183698
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
27183780 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 27183698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 38555126 - 38555045
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| || ||||||||||||| |||||||| ||||| |||||||||| || ||||| ||||||||    
38555126 cccgtgagcatagttcagttggcagagacaatgcattattatatgcaggggtcg-ggttcgaacctcaaacacctcacttatt 38555045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 43774181 - 43774263
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| |||| |||||||| ||| |||||||||| | |||||||| ||||| |||||||||| |||||||||||||||||    
43774181 cccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttatt 43774263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 49019187 - 49019261
Alignment:
55 gcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| ||||||||||||| ||||| || ||||| |||||||| | |||||||| ||||||||    
49019187 gcatagttcagttggtaagacaatgcattattatatgtaggggtcggggttcgaatctcagacaccgcacttatt 49019261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 19137616 - 19137697
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||||  ||||||| | |||||||| || ||||||||||||| ||||||||||| |||||    
19137616 cccgtgagcatagctcagttggcaggaacatgcattgttatatgcaggggccgaggttcgaaccccagacaccccatttatt 19137697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 32508896 - 32508811
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||  ||||||| ||||| |||||||||| |||||||| ||||| |||||||||| |  ||||||||||||||    
32508896 ttgtcccgtgagcctaactcagttgataggataatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttatt 32508811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 36331824 - 36331743
Alignment:
49 ccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| ||| |||| ||| |||||||||||| |||||||| ||||| |||||||||| | |||||||||||||||    
36331824 ccgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt 36331743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 13616175 - 13616091
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||  || ||||||||||||||||||||| ||||| || |||||  ||||||||| | |||||||||||||||    
13616175 tgtcccgtgaacataactcggttggtaggacaatgcattattatatgtaggggtcggagttcgaacctcggacaccccacttatt 13616091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 54983811 - 54983722
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattat----aatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| ||||||||||||| ||||||||||     |||||||| ||||| |||||||||| | ||||||||| |||||    
54983811 ttgtcccgtgagcatagctcagttggtaggataatgcattattatatatatgcaggggtcggggttcgaaccccggacaccccatttatt 54983722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 14417863 - 14417946
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||||| ||| |||||||||||||||||||| |||||||| ||  |  ||||||||| | |||||||||||||||    
14417863 gtcccatgagcatagctcaattggtaggacaatgcattattatatgcaggggctggagttcgaaccccggacaccccacttatt 14417946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 17440065 - 17439982
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| || ||||||||||||||||||||| |||||||| || ||  ||| ||||| | || ||||||||||||    
17440065 gtcccgtgagcatagctcggttggtaggacaatgcattattatatgcaggggccggtgtttgaacctcggataccccacttatt 17439982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 38176053 - 38176132
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||| |||||||||||||||||||| ||| |||||| | || || |||||||||| |||||| ||||||||||    
38176053 cgtgaacatagctcagttggtaggacaatgcaatattatatgctggggccggggttcgaaccccagacagcccacttatt 38176132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7448462 - 7448380
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||| |||| |||||||||||| |||||||| || || | |||||||| |||| ||||||||||||    
7448462 cccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttatt 7448380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7456604 - 7456522
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||| |||| |||||||||||| |||||||| || || | |||||||| |||| ||||||||||||    
7456604 cccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttatt 7456522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 14868681 - 14868763
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| |  ||||||||||||||    
14868681 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatt 14868763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 34503209 - 34503258
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||| ||||||||||| |||||||||||||||||||||||| ||||||||    
34503209 tgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcag 34503258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 125
Target Start/End: Complemental strand, 35849369 - 35849300
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccact 125  Q
    ||||| |||||||||||||||||||||||| |||||||| |   | |||||||||| |||||||||||||    
35849369 catagctcagttggtaggacaatgcattattatatgcagggactgtggttcgaacctcagacaccccact 35849300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 32876211 - 32876151
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||  |||||||||||||||||||||||| |||||||| |||||| |||| ||||    
32876211 gtgagcatatctcagttggtaggacaatgcattattatatgcaggggtcgaagttcaaacc 32876151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 45713474 - 45713558
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||  | |||||||||||||||||||||| ||||| || || ||  ||||||||  | |||||||||||||||    
45713474 tgtcccgtgagcataacttagttggtaggacaatgcattattatatgtaggggccggagttcgaactccggacaccccacttatt 45713558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 129
Target Start/End: Original strand, 53472615 - 53472703
Alignment:
42 cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagagg-tcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||||||| | | |||||||||||||||||||| ||||| ||||| ||| |||| ||||  || ||||||||||||||    
53472615 cattgtcccatgagcatagcttaattggtaggacaatgcattattatatggagaggatcggggtttgaactccaaacaccccacttatt 53472703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 13874933 - 13874851
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||| ||||||||| |||||||||||||| |||||||| ||||| ||||| || | |||||| |||| |||||    
13874933 gtcccgtgaacatagctcagttggt-ggacaatgcattattatatgcaggggtcggggttcaaatcccagacatcccatttatt 13874851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 123
Target Start/End: Complemental strand, 16874288 - 16874213
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccca 123  Q
    ||||||||||||| |||||||| |||   ||||||| | |||||||| || ||||||||||||||| |||||||||    
16874288 cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccgcggacacccca 16874213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 27066605 - 27066688
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||||| |||||||||| || ||  |||||| |||||||| ||||  |||||||||| | |||||||||||||||    
27066605 gtcccgtaagcatagctcagttggtaagataaatcattattatatgcaggggtcagggttcgaaccccggacaccccacttatt 27066688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 110
Target Start/End: Original strand, 34136755 - 34136822
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||| |||||||||| ||||||||||| |||||||||||| ||||| || ||| | |||||||||    
34136755 attgtcctgtgagcatagctcagttggtagaacaatgcattattatatgtaggggttggggttcgaac 34136822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 124
Target Start/End: Original strand, 3784069 - 3784143
Alignment:
51 gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccac 124  Q
    |||||||||| |||||||| ||| |||||||||||| |||| ||| ||||| |||||||||| | ||||||||||    
3784069 gtgagcatagctcagttggcagggacaatgcattattatatacaggggtcggggttcgaaccccggacaccccac 3784143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 10959129 - 10959211
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| ||||  || || || |||||||||| | |||||||||||||||    
10959129 cccgtgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttatt 10959211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 19540334 - 19540384
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||| ||||||||| ||||||||||||||||| |||||| ||||||||    
19540334 ttgtcccatgagcatagctcagttggtaggacaatacattattatatgcag 19540384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 111
Target Start/End: Original strand, 20244140 - 20244194
Alignment:
57 atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||| |||||||||||||||||||||||| |||||||| || || ||||||||||    
20244140 atagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacc 20244194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 24559385 - 24559467
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||| | ||| | ||||||| || |||||||| ||||| |||||||||| | |||||||||||||||    
24559385 cccgtgagcatagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt 24559467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 148
Target Start/End: Original strand, 29507215 - 29507316
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt--agccactaggctacctg 146  Q
    |||||||| ||  |||||||||||||||||||||||| ||||||||  || | |||||||||  ||||||  |||||||||  |||||||||  ||||||    
29507215 ccgtgagcttaactcagttggtaggacaatgcattattatatgcaggagttgtggttcgaactccagacattccacttattcaagccactagattacctg 29507314  T
147 ac 148  Q
    ||    
29507315 ac 29507316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 32665277 - 32665359
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||||| |||||| |||||| |||||||||| |||||||  ||||| ||||| |||  | |||||||||||||||    
32665277 tcccgttagcatagctcagttagtaggataatgcattattatatgcaagggtcggggttcaaactccggacaccccacttatt 32665359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 39492833 - 39492899
Alignment:
63 cagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| |||||||||||||||| |||||||  ||  | |||||||||| |||||||||||||||||    
39492833 cagttgttaggacaatgcattattatatgcatgggctggggttcgaaccccagacaccccacttatt 39492899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 43598796 - 43598858
Alignment:
49 ccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    |||||| ||||||| |||||| || ||||||||||||| |||||||||||||| |||||||||    
43598796 ccgtgatcatagtttagttggcagagacaatgcattattatatgcagaggtcggggttcgaac 43598858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 97
Target Start/End: Original strand, 47427725 - 47427771
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagagg 97  Q
    |||||||||| || ||||||||||||||||||||| |||||||||||    
47427725 gtgagcatagctccgttggtaggacaatgcattattatatgcagagg 47427771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 64 - 129
Target Start/End: Original strand, 37279640 - 37279705
Alignment:
64 agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||| ||||| |||||| |||||||||||| | |||||||||  |||||||||||||||||    
37279640 agttgatagaacaatacattattatatgcagaggttggggttcgaactccagacaccccacttatt 37279705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 109
Target Start/End: Complemental strand, 38682352 - 38682295
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||||| ||||||||||||| |||||| |||||||| ||||| | ||||||    
38682352 tgagcatagttcatttggtaggacaatacattattatatgcaggggtcgggattcgaa 38682295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 34407159 - 34407107
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||||| ||| | |||||||||| |||||||||||||||||    
34407159 atgcattattatatgcaggggttggggttcgaaccccagacaccccacttatt 34407107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 48173284 - 48173364
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||||||||| ||||||||||||| ||||| |  ||| |  ||||||||| | |||||| ||||||||    
48173284 ccgtgagcatagctcagttggtaagacaatgcattattatatgtatgggttggagttcgaaccccggacacctcacttatt 48173364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 19117458 - 19117501
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||||||| ||||||||||||||||| |||||| ||||||||    
19117458 gtgagcatagctcagttggtaggacaatacattattatatgcag 19117501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 20623877 - 20623794
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  |||||| ||||||||||||||||| ||||| || | ||  |||||||||    |||||||||||||||    
20623877 gtcccgtgagcataactcagtttgtaggacaatgcattattatatgtagggatcagggttcgaactcaggacaccccacttatt 20623794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 28206637 - 28206554
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||| |||| ||||||||||||||||  |||||| |||||||  |||||||||| |||||   |||| ||||||||||    
28206637 gtcccgcgagtatagctcagttggtaggacaagacattattatatgcacgggtcgaggtttgaaccctggacatcccacttatt 28206554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 126
Target Start/End: Complemental strand, 34898837 - 34898759
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||||| |||||||||||||||| | | ||||| || |||||||| ||  |||||||||||| ||||||||||||||    
34898837 cccgtgagcttagttcagttggtagggatattgcat-attatatgcaggggctgaggttcgaaccccagacaccccactt 34898759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 129
Target Start/End: Complemental strand, 48347332 - 48347289
Alignment:
86 aatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||| |||||||||| |||||||||||||||||    
48347332 aatatgcaggggtcggggttcgaacctcagacaccccacttatt 48347289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 335127 - 335085
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatg 91  Q
    |||||||||||| | |||||||||||||||||||||| |||||    
335127 ccgtgagcatagcttagttggtaggacaatgcattattatatg 335085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 4045729 - 4045651
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||||||||  |||   ||||||| | |||||||| |||||||||||||||  | |||||||||||||||    
4045729 gtgagtatagttcagttgacagggacatgcattgttatatgcaggggtcgaggttcgaacttcggacaccccacttatt 4045651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 31917966 - 31917884
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||| |||||| ||||||  ||||||| | ||||| |||||||| | |||||||  | |||||||||||||||    
31917966 tcccatgagcatagctcagtttgtaggaacatgcattgttatatgtagaggtcgggcttcgaacttcggacaccccacttatt 31917884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 33072283 - 33072333
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||| ||||||||||  ||||||| |||||||||||||||| ||||||||    
33072283 ttgtctcgtgagcataactcagttgataggacaatgcattattatatgcag 33072333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 41767867 - 41767785
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| ||| |||||||||| | |||||||| ||||   ||||||| | | | |||||||||||||    
41767867 cccgtgagcatagttcagttggcaggaacaatgcattgttatatgcaggggtcattgttcgaatctcgggcaccccacttatt 41767785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 47191369 - 47191451
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| ||  |  ||||||||| |  ||||||||||||||    
47191369 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggagttcgaaccccgaacaccccacttatt 47191451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 97
Target Start/End: Original strand, 51399950 - 51399996
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagagg 97  Q
    |||||||||| ||||||||||||| | |||||||| |||||||||||    
51399950 gtgagcatagctcagttggtaggatattgcattattatatgcagagg 51399996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 129
Target Start/End: Original strand, 12711974 - 12712047
Alignment:
57 atagttcagttggtaggacaatgcattataatatgcagaggtcgag-gttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||  ||||||| | |||||||| ||||| | ||||||||| | ||| |||||||||||    
12711974 atagttcagttggtaggaacatgcatttttatatgcaggggtcgggagttcgaacccctgactccccacttatt 12712047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 26366316 - 26366263
Alignment:
46 gtcccgtgagcatagttcagtt-ggtaggacaatgcattataatatgcagaggt 98  Q
    ||||| ||||||||| |||||| ||||||| |||||||||| ||||||||||||    
26366316 gtcccatgagcatagctcagtttggtaggataatgcattattatatgcagaggt 26366263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 129
Target Start/End: Original strand, 362965 - 363021
Alignment:
73 gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||||  ||||||||| | || ||||||||||||    
362965 gacaatgcattattatatgcaggggtcggagttcgaaccccggataccccacttatt 363021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 2564916 - 2564964
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||  ||||||||||| ||| |||||||| ||||||||    
2564916 gtcccgtgagcataactcagttggtagaacagtgcattattatatgcag 2564964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 129
Target Start/End: Original strand, 2995208 - 2995256
Alignment:
81 attataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||| ||||||| |||||||| || ||||||||||||||    
2995208 attattatatgcaggggtcgagattcgaacctcaaacaccccacttatt 2995256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 4860160 - 4860239
Alignment:
47 tcccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||| ||| |||||||||| ||| | |||||| || ||||||| ||  |||||||||||| ||||||||||||||    
4860160 tcccgtgagcttagctcagttggtacggatattgcatttta-tatgcaggggctgaggttcgaaccccagacaccccactt 4860239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 4880168 - 4880247
Alignment:
47 tcccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||| ||| |||||||||| ||| | |||||| || ||||||| ||  |||||||||||| ||||||||||||||    
4880168 tcccgtgagcttagctcagttggtacggatattgcatttta-tatgcagtggctgaggttcgaaccccagacaccccactt 4880247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 8958358 - 8958406
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||| |||||||||| ||||||||||||| |||||||||  ||||||||    
8958358 gtcctgtgagcatagctcagttggtaggataatgcattactatatgcag 8958406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 126
Target Start/End: Original strand, 9114033 - 9114089
Alignment:
71 aggacaatgcattata-atatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||||||||| |||||||| ||||||| ||||||   ||||||||||||||    
9114033 aggacaatgcattatatatatgcaggggtcgagattcgaattccagacaccccactt 9114089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 129
Target Start/End: Complemental strand, 18020323 - 18020267
Alignment:
73 gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||  ||||||| |||||  |||| |||| |||||||||||||||||    
18020323 gacaatgcattattttatgcaggggtcggtgttcaaaccccagacaccccacttatt 18020267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 28693363 - 28693303
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||||||| |||||||||| ||||||   |||| ||||||||| |||| ||||||||    
28693363 ccgtgagcatagctcagttggtatgacaataatttattatatgcagaagtcggggttcgaa 28693303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 121
Target Start/End: Original strand, 31576509 - 31576581
Alignment:
50 cgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccc 121  Q
    ||||||||||| |||||||||||| |||||||||| | |||||||| ||| | || ||||||  |||||||||    
31576509 cgtgagcatagctcagttggtaggaacaatgcattgttatatgcaggggttggggctcgaactccagacaccc 31576581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 34344869 - 34344829
Alignment:
54 agcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||| ||||||| |||||||||||||||| ||||||||    
34344869 agcatagctcagttgataggacaatgcattattatatgcag 34344829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 130
Target Start/End: Complemental strand, 47062150 - 47062083
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta 130  Q
    |||||||||||||||||||||||| ||||| |  |||||  ||||||||| | ||||||||| ||||||    
47062150 tcagttggtaggacaatgcattattatatg-atgggtcggagttcgaaccccggacaccccatttatta 47062083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 60; Significance: 9e-26; HSPs: 77)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 22966058 - 22965975
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| ||| |||||||||||||||||||| |||||||| || ||||||||||||| |||||||||||||||||    
22966058 gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttatt 22965975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 34948101 - 34948184
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||| || ||||||||||||| | |||||||||||||||    
34948101 gtcccgtgagcatagctcagttggtaggacaatgcattatcatatgcagtggccgaggttcgaaccccggacaccccacttatt 34948184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 23685657 - 23685571
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| ||||||||| ||||||| |||||||||||||||| |||||||| || || |||||||||| |||||||||||||||||    
23685657 attgtcccatgagcatagctcagttgataggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt 23685571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 36316077 - 36315991
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||| ||||||||||||| |||||||||| |||||||| || || |||||||||| | |||||||||||||||    
36316077 attgtcccgtgagcatagctcagttggtaggataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt 36315991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 30644162 - 30644247
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||| |||||||||||||||||||||||| |||||||| || ||  ||||||||| |||||||||||||||||    
30644162 ttgtcccgtgagtatagctcagttggtaggacaatgcattattatatgcaggggccggtgttcgaaccccagacaccccacttatt 30644247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 38778782 - 38778696
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||  |||||||||||||||||||||||| |||||||| || |||||||| |||| | |||| ||||||||||    
38778782 attgtcccgtgagcatatctcagttggtaggacaatgcattattatatgcaggggccgaggttctaaccccggacatcccacttatt 38778696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 46 - 128
Target Start/End: Complemental strand, 44437925 - 44437843
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    ||||||||||||||| |||||| ||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||    
44437925 gtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat 44437843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 46716334 - 46716411
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||    ||||||||||||||    
46716334 tgagcatagctcagttggtaggacaatgcattattatatgcagaggtcggggttcgaaccctgaacaccccacttatt 46716411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 42887148 - 42887232
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||| |||||| |||||| |||||||| ||  |||||||||||| | |||||||||||||||    
42887148 tgtcccgtgagcatagctcagttggtacgacaattcattattatatgcaggggctgaggttcgaaccccggacaccccacttatt 42887232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 2366350 - 2366435
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||  ||||||| |||||||||||||||| |||||||| ||||| |||||||||   ||||||||||||||||    
2366350 ttgtcccgtgagtataactcagttgataggacaatgcattattatatgcaggggtcggggttcgaactctagacaccccacttatt 2366435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 27047809 - 27047732
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||| |||||    
27047809 tgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccatttatt 27047732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 46337968 - 46337903
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||| |||||||||||||||||||||||||||||| |||||||| | ||| ||||||||||    
46337968 gtcccgtgaacatagttcagttggtaggacaatgcattattatatgcagggatcggggttcgaacc 46337903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 47552212 - 47552291
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| |||||||  || || |||||||||| | ||||||| |||||||    
47552212 cgtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggggttcgaaccccggacaccctacttatt 47552291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 5787457 - 5787539
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||| ||| |||||||||||||||||||| |||||||| || || |||| ||||| || ||||||||||||||    
5787457 tcccgtgagtatagctcaattggtaggacaatgcattattatatgcaggggccggggtttgaaccccaaacaccccacttatt 5787539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 41417374 - 41417292
Alignment:
48 cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||| || ||||| || |||||||| ||||| |||||||||| |||||||||||||||||    
41417374 cccgtgagcatagctcagttggcaggaacagtgcatcattatatgcaggggtcggggttcgaaccccagacaccccacttatt 41417292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 56 - 129
Target Start/End: Original strand, 8724385 - 8724458
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||| ||| |||||| |||||||||||||| |  ||||||| | |||||||||||||||    
8724385 catagttcagttggtaggataatacattattatatgcagaggtcgggaatcgaacctcggacaccccacttatt 8724458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 49012391 - 49012476
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||||||||||||||||||||| ||||| || ||||  ||||| ||   ||||||||| |||||||    
49012391 ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgaaggggtcagggttcaaattccagacaccctacttatt 49012476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 2261581 - 2261501
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| ||| |||||||||||||||||||| |||||||| || || |||||||| | | ||||||| |||||||    
2261581 ccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaatcccggacacccaacttatt 2261501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 109
Target Start/End: Original strand, 8195909 - 8195973
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||||||||||| |||||||||||||||||||||||| |||| ||| || || ||||||||    
8195909 tgtcccgtgagcatagctcagttggtaggacaatgcattattatatccaggggccggggttcgaa 8195973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 126
Target Start/End: Complemental strand, 14967734 - 14967654
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||| |||||||||  |||||||||||||||||||||||| ||||| || ||||| |||| ||||| |||||||| |||||    
14967734 gtcctgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactt 14967654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 126
Target Start/End: Complemental strand, 15397210 - 15397130
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||| |||||||||  |||||||||||||||||||||||| ||||| || ||||| |||| ||||| |||||||| |||||    
15397210 gtcctgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactt 15397130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 17900979 - 17900896
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||||| | |||||||||||||||||||||| |||||||| || || || ||||||| | ||| |||||||||||    
17900979 gtcccatgagcatagcttagttggtaggacaatgcattattatatgcaggggccggggctcgaaccccggactccccacttatt 17900896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 21086099 - 21086182
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||| ||||| |||||||||||||||||||||||| |||||||| | |||| ||||||||  | ||||||| |||||||    
21086099 gtcccatgaacatagctcagttggtaggacaatgcattattatatgcagggatcgaagttcgaactccggacacccaacttatt 21086182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 22706128 - 22706045
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||| |||||||||||||||||| ||||| |||||||| ||  ||||||| |||  | |||||||||||||||    
22706128 gtcccgtgaacatagctcagttggtaggacaatgtattattatatgcaggggctgaggttcaaactccggacaccccacttatt 22706045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 30152740 - 30152819
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||| |||||||||||||||||||||||| ||||  || ||||| |||||||||| |  ||||||||||||||    
30152740 cgtgagcttagctcagttggtaggacaatgcattattatatataggggtcggggttcgaaccccgaacaccccacttatt 30152819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 31694066 - 31694148
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||| ||||||||| |||||||||||||| |||||||| || |||| |||||||  | |||||||||||||||    
31694066 gtcccgtgaacatagctcagttggt-ggacaatgcattattatatgcaggggacgagattcgaactccggacaccccacttatt 31694148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 45198198 - 45198115
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  ||||||||||||| |||||||||| |||||||| | | ||| |||||||| | ||||||||| |||||    
45198198 gtcccgtgagcataactcagttggtaggataatgcattattatatgcagtgattgagattcgaaccccggacaccccatttatt 45198115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 55 - 129
Target Start/End: Complemental strand, 924383 - 924309
Alignment:
55 gcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||||||||||| | |||||||| ||||| || ||| | |||||||||| |||||||||||||||||    
924383 gcatagctcagttggtaggatagtgcattattatatgtaggggttggggttcgaaccccagacaccccacttatt 924309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 127
Target Start/End: Original strand, 4818015 - 4818097
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgc-agaggtcgaggttcgaaccgcagacaccccactta 127  Q
    ||||||||||||| | |||||||||||||||||||||||| ||||||  | || || |||||||||  |||||||||||||||    
4818015 gtcccgtgagcatcgctcagttggtaggacaatgcattattatatgcggggggccgtggttcgaactccagacaccccactta 4818097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 7263099 - 7263033
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||| |||| |||||||||||||||||||||||| ||||| |||||| |  |||||||||    
7263099 tgtcccgtgagtatagctcagttggtaggacaatgcattattatatgtagaggttggagttcgaacc 7263033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 14818464 - 14818382
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| ||| |||||||| |||||||| ||||| ||||| |||| || ||||||||||||||    
14818464 cccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttatt 14818382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 15265462 - 15265380
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| ||| |||||||| |||||||| ||||| ||||| |||| || ||||||||||||||    
15265462 cccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttatt 15265380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 21285452 - 21285370
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||| | |||||||| || || |||||||||| | |||||||||||||||    
21285452 cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttatt 21285370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 22741198 - 22741283
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc--gaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| || ||||||||||||||||||||| ||||||||  |||  | |||||||| | | |||||||||||||||    
22741198 gtcccgtgagcatagctcggttggtaggacaatgcattattatatgcagtagtcagggggttcgaatctcggacaccccacttatt 22741283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 43970953 - 43970888
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||||||  ||||||||||| |||||||||||| ||||||||| | || ||||||||||    
43970953 gtcccgtgagcataactcagttggtagaacaatgcattattatatgcagaagacggggttcgaacc 43970888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 129
Target Start/End: Complemental strand, 45011740 - 45011675
Alignment:
64 agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| ||||||||||| |  |||||||||| | || ||||||||||||    
45011740 agttggtaggacaatgcattattatatgcagaggccagggttcgaacctcggagaccccacttatt 45011675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 110
Target Start/End: Original strand, 21925470 - 21925534
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||||||||||| ||| |||||||||||||||||||| |||| || |||||| |||| ||||    
21925470 gtcccgtgagcatagctcaattggtaggacaatgcattattatatacataggtcggggtttgaac 21925534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 25711232 - 25711148
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||  ||||||| ||||| |||||||||| ||||| || || || |||||||||| | |||||||||||||||    
25711232 tgtcccgtgagtataactcagttgataggataatgcattattatatgtaggggccggggttcgaacctcggacaccccacttatt 25711148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 110
Target Start/End: Original strand, 29778976 - 29779040
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||||||||||| ||| ||||||||| |||||||||| |||||||| |||||  ||||||||    
29778976 gtcccgtgagcatagctcaattggtaggataatgcattattatatgcaggggtcggagttcgaac 29779040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 32814825 - 32814905
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| ||||||||||||   ||||||||| |||||||| |||||  ||||||| | | |||||||||||||||    
32814825 ccgtgagcatagctcagttggtagggacatgcattattatatgcaggggtcggagttcgaatcccggacaccccacttatt 32814905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 34962072 - 34962024
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||| |||||||||| |||||||||||||||||||||||| ||||||||    
34962072 gtcctgtgagcatagctcagttggtaggacaatgcattattatatgcag 34962024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 110
Target Start/End: Complemental strand, 35919771 - 35919707
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||||||||||| ||||||| || ||||||||||||| ||||| | ||||||| ||||||||    
35919771 gtcccgtgagcatagctcagttgttaagacaatgcattattatatgtaaaggtcgaagttcgaac 35919707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 4590701 - 4590658
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||||||| |||||||||||||||||||||||| ||||||||    
4590701 gtgagcatagctcagttggtaggacaatgcattattatatgcag 4590658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 7908705 - 7908787
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||| |||||  |||||||||||||| |||||||| |||||||||||  |||||||||||| || |||||| |||||||    
7908705 gtcctgtgaacatagcacagttggtaggaca-tgcattattatatgcagaggctgaggttcgaaccccaaacaccctacttatt 7908787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 19126740 - 19126815
Alignment:
55 gcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||||||||||| ||||||||||| |||| ||| ||  |||||||||||| | |||||||||||||||    
19126740 gcatagctcagttggtaggaacaatgcattattatatacaggggctgaggttcgaaccccggacaccccacttatt 19126815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 22047520 - 22047563
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||||||| |||||||||||||||||||||||| ||||||||    
22047520 gtgagcatagctcagttggtaggacaatgcattattatatgcag 22047563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 29710200 - 29710118
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| |||| |||||||||||||||||||||||| ||||| || ||  |||||||||||   |||||| |||||||||    
29710200 gtcccgtgagtatagctcagttggtaggacaatgcattattatatgtag-ggctgaggttcgaactctagacactccacttatt 29710118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 31475940 - 31475857
Alignment:
47 tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||| ||| ||| |||||||| |||||||| ||  | |||||||||| | |||||||||||||||    
31475940 tcccgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttatt 31475857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 8725240 - 8725155
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| |||||| |||| |||||||||||||| ||||||||| |||||||| |  || |||||||||| |  ||||||||||||||    
8725240 attgtctcgtgagaatagctcagttggtaggacgatgcattattatatgcag-gaccggggttcgaaccccgaacaccccacttatt 8725155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 11808034 - 11808116
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||| ||| ||||||||   ||||||| | |||||||| ||||| |||||||||| | |||||||||||||||    
11808034 tcccgtgagcttagctcaattggtagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt 11808116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 126
Target Start/End: Original strand, 24188471 - 24188548
Alignment:
49 ccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||||| |||||||||||| | | ||||| || |||||||| ||||| |||||||||| ||||||||||||||    
24188471 ccgtgagcatagctcagttggtagggatactgcat-attatatgcaggggtcggggttcgaaccccagacaccccactt 24188548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 29658371 - 29658289
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| |||| || ||||||||||| | |||||||| || || |||||||||| | |||||||||||||||    
29658371 cccgtgagcatagctcaattggcagcgacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttatt 29658289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 41139083 - 41139145
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| ||||| ||||||||    
41139083 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaa 41139145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 85
Target Start/End: Original strand, 45197314 - 45197352
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattat 85  Q
    |||||||||||||| ||||||||||||||||||||||||    
45197314 tcccgtgagcatagctcagttggtaggacaatgcattat 45197352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 127
Target Start/End: Original strand, 7465462 - 7465542
Alignment:
47 tcccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta 127  Q
    |||||||||||||| |||||||| || |||| |||||||| |||||||| || || |||||||||| | |||||||||||||    
7465462 tcccgtgagcatagctcagttggcagagaca-tgcattattatatgcaggggccggggttcgaaccccggacaccccactta 7465542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 37917389 - 37917470
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||||||||  |||||| || |||||||| ||| | ||||| ||||  | ||||||||||||||    
37917389 cccgtgagcatagctcagttggtaggaacatgcataattatatgcaggggttggggttcaaaccctaaacaccccacttatt 37917470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 43635585 - 43635666
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||  |||||||| || |  ||||||| | |||||||| ||||| |||||||||| | |||||||||||||||    
43635585 cccgtgagcataactcagttggcagaaacatgcattgttatatgcagcggtcggggttcgaaccccggacaccccacttatt 43635666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 4104474 - 4104522
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    |||||||||||||||| ||| ||| |||||||||||||||| |||||||    
4104474 tgtcccgtgagcatagctcaattgttaggacaatgcattattatatgca 4104522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 90
Target Start/End: Complemental strand, 25087050 - 25087006
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatat 90  Q
    ||||||||||||||||| |||| ||||||||||||||||| ||||    
25087050 gtcccgtgagcatagtttagttcgtaggacaatgcattattatat 25087006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 25818281 - 25818329
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||  ||||||||||||| |||||||||| ||||||||    
25818281 gtcccgtgagcataactcagttggtaggataatgcattattatatgcag 25818329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 13905526 - 13905443
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||| |||||||||||||||||| ||||| |||  ||| || ||  |||||||||  ||||||| ||||||||    
13905526 gtcccgtgaacatagctcagttggtaggacaatgtattattataaacaggggccggagttcgaaccctagacaccacacttatt 13905443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 22660736 - 22660819
Alignment:
47 tcccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||||  | ||| |||||||| | ||||| || || || |||||||||| || ||||||||||||||    
22660736 tcccgtgagcatagttcagttgacagggataatgcattgttatatgtaggggccggggttcgaaccccaaacaccccacttatt 22660819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 24396956 - 24397023
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| ||||||||||||||| |||||||| |||||  |||||||||   ||||||| |||||||    
24396956 tcagttggcaggacaatgcattattatatgcaggggtcggagttcgaaccctggacaccctacttatt 24397023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 27907980 - 27907913
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||| |||||||| || || |||  ||| | | |||||||||||||||    
27907980 tcagttggtaggacaatgcattattatatgcaggggccggggtaagaatctcggacaccccacttatt 27907913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 38025336 - 38025419
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||| ||| ||| |||||||||||||||| ||||||||  || | |||||||||| | ||||  |||||||||    
38025336 gtcctgtgagcatagctcatttgataggacaatgcattattatatgcaggagttggggttcgaacctcggacattccacttatt 38025419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 42260130 - 42260048
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| |||||| ||||||||| |||||||||||| ||||  || |||||  ||||||||| || ||| ||||||||||    
42260130 gtcccgtgagtatagttaagttggtagaacaatgcattattatatataggggtcggagttcgaacccca-acatcccacttatt 42260048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 109
Target Start/End: Original strand, 48082195 - 48082258
Alignment:
47 tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||| | ||||||||||||| |||| ||||||| ||||| || ||||||||||||||    
48082195 tcccgtgagcacaattcagttggtaggaacaacgcattattatatgtaggggtcgaggttcgaa 48082258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 109
Target Start/End: Complemental strand, 28735292 - 28735235
Alignment:
52 tgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||| ||||||||||| ||||||||||| ||| |||||||||||||| |||||||    
28735292 tgagcataattcagttggtaaggacaatgcataata-tatgcagaggtcgaagttcgaa 28735235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 36176863 - 36176949
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| || ||| ||||| |||||||||||||||||||||||| ||||| || ||   |||||| |||| | |||||| ||||||||    
36176863 attgttccatgaacatagctcagttggtaggacaatgcattattatatgtaggggctaaggttcaaaccccggacacctcacttatt 36176949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 38792212 - 38792290
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||  ||||||||||| ||||||||||||| |||||||| ||||   ||| ||||| | ||||||| |||||||    
38792212 gtgagcatgattcagttggtaagacaatgcattattatatgcaggggtcagagtttgaaccccggacaccctacttatt 38792290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 45417466 - 45417516
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||||| |||||||| || |||||| ||||| ||||||||    
45417466 ttgtcccgtgagcatagctcagttggcagaacaatgtattattatatgcag 45417516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7392404 - 7392323
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| |||| ||||  ||||||| | |||||||||||| | |||| ||||| |  ||||||||||||||    
7392404 cccgtgagcatagctcaattggcaggaacatgcattgttatatgcagaggttggggtttgaaccccgaacaccccacttatt 7392323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 126
Target Start/End: Original strand, 22590671 - 22590738
Alignment:
58 tagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||||||| ||||| |||| ||| |||| ||||||||| |||||||||| ||||||||||||||    
22590671 tagttcagttggtagggacattgca-tattatatacagaggtcggggttcgaacc-cagacaccccactt 22590738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 121
Target Start/End: Original strand, 30741557 - 30741634
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccc 121  Q
    ||||||||||||||||  ||||||||||||| |||| ||| | |||||||| || ||  ||||||||| | |||||||    
30741557 ttgtcccgtgagcataactcagttggtaggataatgtattgttatatgcaggggccggtgttcgaaccccggacaccc 30741634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 37410578 - 37410498
Alignment:
49 ccgtgagcatagttcagttggt-aggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| ||||||||| ||||| ||||||| | |||||||| |||| ||||||||||  | |||||| ||||||||    
37410578 ccgtgagcatagctcagttggtaaggac-atgcattgttatatgcaggggtcaaggttcgaactccggacacctcacttatt 37410498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 10474608 - 10474529
Alignment:
50 cgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||||| ||| || |||| | |||||||| ||||| ||||||| || | |||||| ||||||||    
10474608 cgtgagcatagttcagttggtagagac-atacattgttatatgcaggggtcggggttcgacccccggacacctcacttatt 10474529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 24579355 - 24579303
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||||| ||  ||| |||||||| |||||||||||||||||    
24579355 atgcattattatatgcaggggatgagattcgaaccccagacaccccacttatt 24579303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 60; Significance: 9e-26; HSPs: 66)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 19642647 - 19642564
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||  ||||| |||||||||| |||||||||||||||||    
19642647 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcatcggtcggggttcgaaccccagacaccccacttatt 19642564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 32057029 - 32057112
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| ||||||| |||||||||||||||| |||||||| |||||||||||||||| |||| | ||||||||||    
32057029 gtcccgtgagcatagctcagttgataggacaatgcattattatatgcagtggtcgaggttcgaaccccagagatcccacttatt 32057112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 22389852 - 22389767
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||  |||||||| | | |||||||||||||||    
22389852 ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcagggttcgaatcccggacaccccacttatt 22389767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 10377225 - 10377141
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||| |||||||||||||||||||||||| ||||||||||| || |||||||||| |  ||||||||||||||    
10377225 tgtcccgtgagtatagctcagttggtaggacaatgcattattatatgcagaggccggggttcgaaccccgaacaccccacttatt 10377141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 12089091 - 12089175
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||||||||||||||||| |||||||| || ||  ||||||||| | |||||||||||||||    
12089091 tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttatt 12089175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 30566053 - 30566136
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||||||||| || ||| ||||| | |||||||||||||||    
30566053 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttatt 30566136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 9491836 - 9491752
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||  |||||||||||||||||||||||| ||||| || || || |||||||||| | |||||||||||||||    
9491836 tgtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacaccccacttatt 9491752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 34365729 - 34365813
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||||||||||||||||||||||| || ||||| || || |||||||||| |  |||| |||||||||    
34365729 tgtcccgtgagcatagttcagttggtaggacaatgcattattatgtgcaggggccggggttcgaacctcgaacactccacttatt 34365813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 7563676 - 7563593
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| | |||||| ||||  ||||| |||| | |||||||||||||||    
7563676 gtcccgtgagcatagctcagttggtaggacaatgcattattacatgcaggggtcagggttcaaaccccggacaccccacttatt 7563593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9064862 - 9064944
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| |||||||||||||||||    
9064862 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt 9064944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 46 - 148
Target Start/End: Original strand, 10373590 - 10373691
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttattagccactaggctacct 145  Q
    ||||||||||||||  | ||||||||| |||||||||||| |||||||| ||||| |||||||||| | ||||||| | ||  |||||||||||||||||    
10373590 gtcccgtgagcataacttagttggtagaacaatgcattattatatgcaggggtcggggttcgaaccccggacacccgaatt-ctagccactaggctacct 10373688  T
146 gac 148  Q
    |||    
10373689 gac 10373691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 18244112 - 18244047
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||| ||| ||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||    
18244112 gtcccatgaacatagctcagttggtaggacaatgcattattatatgcagaggtcggggttcgaacc 18244047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 12128005 - 12127926
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| |||||||| |||||   |||||||| | ||||| |||||||||    
12128005 cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggaattcgaaccccggacacgccacttatt 12127926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 15289051 - 15288972
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||||||||||| |||||||| ||||| || ||  | |||||||||  |||||||||||||||||    
15289051 cgtgagcatagttcagttggtaggacattgcattattatatgtaggggctggggttcgaactccagacaccccacttatt 15288972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 19165362 - 19165428
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||| |||||||||||| | |||||||||| | |||||||||||||||    
19165362 tcagttggtaggacaatgcattattatatgcagaggttggggttcgaacc-ccgacaccccacttatt 19165428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 126
Target Start/End: Complemental strand, 25064767 - 25064689
Alignment:
48 cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||||||||||||||||| ||||| |||||||| |||||||| ||| | |||||||||| ||||||||||||||    
25064767 cccgtgagcatagttcagttggtatggaca-tgcattattatatgcaggggttggggttcgaaccccagacaccccactt 25064689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 5134533 - 5134451
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||| |||||||| || ||||||||||| | ||||||||||| || |||||||||| |||||||||||||||||    
5134533 cccgtaagcatagctcagttggcagagacaatgcattgttatatgcagaggccgcggttcgaacctcagacaccccacttatt 5134451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 35190759 - 35190841
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||| ||||||||||| |||||||||||| |||||||| |||||  ||||||||| |  ||||||||||||||    
35190759 tcccatgagcatagctcagttggtagaacaatgcattattatatgcaggggtcggagttcgaaccccgaacaccccacttatt 35190841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 110
Target Start/End: Original strand, 8233081 - 8233145
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||  |||||||||    
8233081 gtcccgtgagcatagctcagttggtaggacaatacattattatatacagaggtcagggttcgaac 8233145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 34396078 - 34396126
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||||||||||||||||||||||| ||||||||||||| ||||||||    
34396078 gtcccgtgagcatagttcagttggtacgacaatgcattattatatgcag 34396126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 130
Target Start/End: Original strand, 2945592 - 2945675
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta 130  Q
    ||||||||||||| |||||||| ||| |||||||||| | |||||||| ||||| ||||| |||| | ||||||||||||||||    
2945592 cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcaaacctcggacaccccacttatta 2945675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 125
Target Start/End: Original strand, 9438313 - 9438376
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccact 125  Q
    |||||||||||||||||||||||| |||||||| ||| | |||||||||| | |||||||||||    
9438313 tcagttggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacaccccact 9438376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 18631467 - 18631550
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||| ||||||||||||||||| |||| | |||||||| ||||| | |||||||| || | ||||||||||||    
18631467 gtcctgtgagcatagctcagttggtaggacaatacattgttatatgcaggggtcgggattcgaaccccaaataccccacttatt 18631550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21507301 - 21507218
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| | |||||||||||||||| ||||| |||||||| |||||  ||| ||||  | |||||||||||||||    
21507301 gtcccgtgagcatagcttagttggtaggacaatgtattattatatgcaggggtcggagtttgaactccggacaccccacttatt 21507218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 6143961 - 6144042
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| ||||| || ||||| |||||||||| | |||||||||||||||    
6143961 cccgtgagcatagctcagttggcagggacaatgcattattatatgtaggggtcg-ggttcgaaccccggacaccccacttatt 6144042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 126
Target Start/End: Original strand, 11982755 - 11982836
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||| |||||||| ||||||||||| | |||||||||| |||||||| ||||| |||| ||||| | ||||||||||||    
11982755 ttgtcccgggagcatagctcagttggtagaataatgcattattatatgcaggggtcg-ggtttgaaccccggacaccccactt 11982836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 14981801 - 14981719
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || ||||||||||   |||||||||||||||    
14981801 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttatt 14981719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 22501012 - 22501066
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc 99  Q
    |||||| ||||||||| |||||||||||||||||||||||| |||||||| ||||    
22501012 tgtcccatgagcatagctcagttggtaggacaatgcattattatatgcaggggtc 22501066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 5288442 - 5288381
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    |||||||||||  |||||||||||||||||||||||| |||||||| ||||| ||| |||||    
5288442 ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggtccgaac 5288381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 16269819 - 16269734
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||||||| || |||||||||||| |||||||| |||||||| ||| |||| ||||||| |  || |||||||||||    
16269819 ttgtctcgtgagcatagctcggttggtaggacagtgcattattatatgcaggggttgaggatcgaaccccgaacgccccacttatt 16269734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 20716482 - 20716409
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||||||||||||||||| ||||| || ||||| | |||||||  |||| ||||||||||||    
20716482 catagctcagttggtaggacaatgcattattatatgtaggggtcgggattcgaactccagataccccacttatt 20716409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 25020622 - 25020545
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||| ||||||||| ||||||||| |||||||| || |  |||||||||| | |||||||||||||||    
25020622 tgagcatagctcagctggtaggacgatgcattattatatgcaggggcctgggttcgaaccccggacaccccacttatt 25020545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 129
Target Start/End: Original strand, 26528580 - 26528645
Alignment:
64 agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||||||||| |||||||| ||||| ||||| |||| | |||||||||||||||    
26528580 agttggtagaacaatgcattattatatgcaggggtcggggttcaaacctcggacaccccacttatt 26528645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 30833018 - 30833095
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||| |||   ||||||| | |||||||| ||||| |||||||||| | |||||||||||||||    
30833018 tgagcatagttcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt 30833095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 12291164 - 12291248
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||  ||||||| ||| |||||||||||| ||||| || ||| |||||| ||||  ||||||||||| |||||    
12291164 tgtcccgtgagcataactcagttgttagaacaatgcattattatatggaggggttgaggttagaacgccagacaccccatttatt 12291248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 34792942 - 34792879
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||||| ||||||||| |||||||||||||| |||||||| ||||  ||||||||||    
34792942 tcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggtctgggttcgaacc 34792879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 109
Target Start/End: Original strand, 16801784 - 16801847
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||||||| ||||||||||||||||  |||||| ||||||||  |||| ||||||||    
16801784 gtcccgtgagcatagctcagttggtaggacaaaacattattatatgcaggagtcggggttcgaa 16801847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 19417817 - 19417900
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||||| || |||||||||| |||| ||||| |||||||| | ||| | |||||| | |||||||||||||||||    
19417817 gtcccgtaagcatagctctgttggtaggataatgtattattatatgcagggatcgggattcgaatcccagacaccccacttatt 19417900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 111
Target Start/End: Original strand, 7303786 - 7303852
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||||||  |||||||||||||||||  ||||| |||||||||||| | | ||||||||    
7303786 tgtcccgtgagcataactcagttggtaggacaatatattattatatgcagaggttgggattcgaacc 7303852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 122
Target Start/End: Original strand, 10455739 - 10455813
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc 122  Q
    |||||||||||||||||||||| ||||  ||||||| | |||||||| || || |||||||||| | ||||||||    
10455739 cccgtgagcatagttcagttggcaggaacatgcattgttatatgcaggggccggggttcgaaccccggacacccc 10455813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 24256913 - 24256994
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||  ||||||||||| |||| |||||||| |||||||| || ||||||||||||| | || ||||||||||||    
24256913 cccgtgagcataagtcagttggtagagaca-tgcattattatatgcaggggccgaggttcgaaccccggataccccacttatt 24256994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 108
Target Start/End: Original strand, 24623517 - 24623579
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga 108  Q
    ||||| ||| ||||| |||||||||||||||||||||||| |||||||  ||||| |||||||    
24623517 gtcccatgaacatagctcagttggtaggacaatgcattattatatgcaagggtcggggttcga 24623579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 753402 - 753329
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| | ||||||||||||| |||||| ||||| || ||||| ||||||||||   |||||||||||||||    
753402 catagtttaattggtaggacaatacattattatatgtaggggtcggggttcgaaccctggacaccccacttatt 753329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 6025486 - 6025421
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||| ||||||  ||||||||||||| |||||||||| |||||||| ||||| | ||||||||    
6025486 gtcccgtaagcataactcagttggtaggataatgcattattatatgcaggggtcgggattcgaacc 6025421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 127
Target Start/End: Original strand, 7392537 - 7392614
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta 127  Q
    ||||| ||||| |||||| |||||| |||||||||| ||||||| |||| | | |||||||| || ||||||||||||    
7392537 cgtgaacatagctcagttagtaggataatgcattattatatgcaaaggttgggattcgaacctcaaacaccccactta 7392614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 26669757 - 26669676
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||||||||   |||||| || ||||| || ||  | |||||||||| |||||||||||||||||    
26669757 cccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttatt 26669676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 26878801 - 26878858
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||| ||||||||||| ||||||||||||| |||||||| ||| | ||||||||    
26878801 tgagcataattcagttggtaagacaatgcattattatatgcaggggttgtggttcgaa 26878858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 34521988 - 34522053
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||||||| ||||||||||||||||| ||||| |||| ||| || ||  |||||||||    
34521988 gtcccgtgagcatagtccagttggtaggacaatgaattattatatccaggggacggagttcgaacc 34522053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 106
Target Start/End: Complemental strand, 17419797 - 17419737
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttc 106  Q
    ||||||||||||||| |||||| ||||||||||  ||||| |||||||| ||| |||||||    
17419797 gtcccgtgagcatagctcagttagtaggacaatatattattatatgcaggggttgaggttc 17419737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 108
Target Start/End: Original strand, 18991477 - 18991541
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga 108  Q
    |||||||| |||||||| |||||||||| ||||||||||||| ||||| || || || |||||||    
18991477 ttgtcccgcgagcatagctcagttggtaagacaatgcattattatatgtaggggccggggttcga 18991541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 126
Target Start/End: Complemental strand, 34432868 - 34432789
Alignment:
47 tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    |||||||||| |||||||||||||||| | | ||||| || |||||||||||| | |||||||||| ||||||| ||||||    
34432868 tcccgtgagcttagttcagttggtagggatattgcat-attatatgcagaggttggggttcgaaccccagacactccactt 34432789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 6530300 - 6530221
Alignment:
51 gtgagcatagttcagttggtaggacaatgca-ttataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||  ||||||||||| |||||||| |||| |||||||| || || ||||| |||| | |||||||||||||||    
6530300 gtgagcataaatcagttggtagaacaatgcaattattatatgcaggggccggggttcaaacctcggacaccccacttatt 6530221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 16251619 - 16251540
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||  | ||||||||||||||||||  || |||||||| |||||  ||||||||  | |||||||||||||||    
16251619 cgtgagcataacttagttggtaggacaatgcacaattatatgcaggggtcgttgttcgaactccggacaccccacttatt 16251540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Original strand, 22983599 - 22983658
Alignment:
70 taggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||| |||||||| || || |||||||||| | |||||||||||||||    
22983599 taggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttatt 22983658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 129
Target Start/End: Original strand, 23771036 - 23771111
Alignment:
54 agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||| |||||||||||||||||||| |||||||| ||  | |||||||||  | ||||||||| |||||    
23771036 agcatagctcaattggtaggacaatgcattattatatgcaggggaaggggttcgaactccggacaccccatttatt 23771111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Complemental strand, 23804809 - 23804750
Alignment:
70 taggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||| |||||||| || || |||||||||| | |||||||||||||||    
23804809 taggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttatt 23804750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 91
Target Start/End: Complemental strand, 31741557 - 31741518
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatg 91  Q
    ||||||||| |||||||||||||||||||||||| |||||    
31741557 tgagcatagctcagttggtaggacaatgcattattatatg 31741518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 2044710 - 2044648
Alignment:
49 ccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    |||||||  ||||||||||||||  |||||||||| |||||||||||||||||  ||||||||    
2044710 ccgtgagtttagttcagttggtatagacaatgcataataatatgcagaggtcggagttcgaac 2044648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 3448348 - 3448430
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| |||| ||| |||||||||| | ||| |||| || || |||||||||| | |||||||||||||||    
3448348 cccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttatt 3448430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 12101898 - 12101964
Alignment:
63 cagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||| |||||||| || ||  ||||||||| | ||||||| |||||||    
12101898 cagttggtaggacaatacattattatatgcaggggccggcgttcgaaccccggacaccctacttatt 12101964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 20568355 - 20568274
Alignment:
48 cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||| |||||||||| ||||| ||||| ||| ||||||| ||||| |||||||||| |  ||||||||||||||    
20568355 cccgtgagcttagctcagttggtaaggacattgcataata-tatgcaggggtcggggttcgaaccccgaacaccccacttatt 20568274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 29284118 - 29284196
Alignment:
52 tgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||  ||||||||||||| ||||| ||||| ||||| || | ||| |||||||||| | |||||||||||||||    
29284118 tgagcataactcagttggtaggaacaatgtattattatatgtagggatcggggttcgaaccccggacaccccacttatt 29284196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 6219351 - 6219431
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||| |||||||| |||   ||||||||| |||| ||| ||||| | |||||||| |||||||||||||||||    
6219351 cccgtgaacatagctcagttggcagggacatgcattattatatacagtggtcg-gattcgaaccccagacaccccacttatt 6219431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 10424636 - 10424552
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||||||  ||||||| ||| |||||||||||| ||||| || ||||| |||| ||| | | |||||||||||||||    
10424636 ttgtctcgtgagcataactcagttgatag-acaatgcattattatatgtaggggtcgtggtttgaatcccggacaccccacttatt 10424552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 126
Target Start/End: Original strand, 11636685 - 11636738
Alignment:
73 gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||||||||| |||||||| |||||  ||||||||| | ||||||||||||    
11636685 gacaatgcattattatatgcaggggtcggagttcgaaccccggacaccccactt 11636738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Original strand, 1488114 - 1488166
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| | |||||||||||||| |||||||||| || |||||||| |||||    
1488114 atgcattgttatatgcagaggtcggggttcgaaccccaaacaccccatttatt 1488166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 83)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 9524950 - 9525035
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| ||||||||| |||||||    
9524950 ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttatt 9525035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 15042465 - 15042382
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
15042465 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 15042382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 24608583 - 24608500
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| ||||||||| |||||||    
24608583 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttatt 24608500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 42 - 128
Target Start/End: Original strand, 17980273 - 17980359
Alignment:
42 cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    ||||||||||||||||||| |||||||||||||||| ||||||| |||||||| || || |||||||||| | ||||||||||||||    
17980273 cattgtcccgtgagcatagctcagttggtaggacaaagcattattatatgcaggggccggggttcgaaccccggacaccccacttat 17980359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 13762614 - 13762529
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||   ||||||||| | |||||||||||||||    
13762614 ttgtcctgtgagcatagttcagttggtaggacaatgcattattatatgcaggggtcagtgttcgaaccacggacaccccacttatt 13762529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 34073340 - 34073256
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| ||||||||||||||||| |||||||||| ||||| || |||| ||||||||||| | |||||||||||||||    
34073340 tgtcccgtgagcgtagttcagttggtaggataatgcattattatatgtaggggtcaaggttcgaaccccggacaccccacttatt 34073256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 2376513 - 2376596
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||| |||||||||||||||||||| |||||||| ||||  |||||||||| | ||||| |||||||||    
2376513 gtcccgtgagcatagttcaattggtaggacaatgcattattatatgcaggggtccgggttcgaacctcggacactccacttatt 2376596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 4798644 - 4798558
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||| ||||||||||||| |||||||||| |||||||| || || |||||||||| | |||||||||||||||    
4798644 attgtcccgtgagtatagctcagttggtaggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 4798558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 42688049 - 42688134
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||||||||||||||||||||||||||||| ||||| || ||||| | |||||||| |  ||||||||||||||    
42688049 ttgtctcgtgagcatagttcagttggtaggacaatgcattattatatgtaggggtcgggattcgaaccccgaacaccccacttatt 42688134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 44 - 128
Target Start/End: Original strand, 43847695 - 43847779
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    ||||| ||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| |  |||||||||||||    
43847695 ttgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttat 43847779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 125
Target Start/End: Original strand, 25119203 - 25119282
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccact 125  Q
    ||||||||||||||||||| |||||||||||||||||||| |||||||| ||| | |||||||||| | |||| ||||||    
25119203 gtcccgtgagcatagttcaattggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacatcccact 25119282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 39484470 - 39484387
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||| || || ||||||||   | |||||||||||||||    
39484470 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaatgccggacaccccacttatt 39484387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 43468805 - 43468722
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||| | ||||| || ||||| |||||||||  | |||||||||||||||    
43468805 gtcccgtgagcatagctcagttggtaggacaatgcattgttatatgtaggggtcggggttcgaactccggacaccccacttatt 43468722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 23857425 - 23857340
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca-gaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||||||||||||||||| ||||||| | || || |||||||||| | ||||||| |||||||    
23857425 tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcagggggccggggttcgaacctcggacacccgacttatt 23857340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 9737461 - 9737377
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||||||||||||||||| |||||| ||||  || || ||||||||||||  | |||||||||||||||    
9737461 tgtcccgtgagcatagctcagttggtaggacaatacattattatatataggggccgaggttcgaactccggacaccccacttatt 9737377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 27558970 - 27558888
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||| ||| ||||||||| |||||||||| |||||||| ||||| | |||||||| |||||||||||||||||    
27558970 gtcccgtgagcgtagctcatttggtaggataatgcattattatatgcaggggtcgggattcgaacc-cagacaccccacttatt 27558888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 2800015 - 2800097
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
2800015 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 2800097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 45 - 127
Target Start/End: Complemental strand, 25689489 - 25689407
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta 127  Q
    |||| ||||||||||| ||||||||||||||| |||||||| ||||| || || ||||||||||||| | ||||||| |||||    
25689489 tgtctcgtgagcatagctcagttggtaggacactgcattattatatgtaggggccgaggttcgaaccccggacaccctactta 25689407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 6064370 - 6064455
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| ||| ||||| |||||||||||||| |||||||| ||||| |||||||||| | |||||  ||||||||    
6064370 ttgtcccgtgagcttagctcaattggttggacaatgcattattatatgcaggggtcggggttcgaacctcggacacttcacttatt 6064455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 14010874 - 14010789
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| |||||||||| |||| |||||||| |||||    ||||| |||||||||| | |||||||||||||||    
14010874 ttgtcccgtgagcatagctcagttggtaagacagtgcattattatatgttatggtcggggttcgaaccccggacaccccacttatt 14010789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 5184988 - 5184904
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||| |||||||||||||||||| ||||| |||||||| ||  | ||||||||||   |||||||||||||||    
5184988 tgtcctgtgagcatagctcagttggtaggacaatggattattatatgcaggggctggggttcgaaccctggacaccccacttatt 5184904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 17987550 - 17987466
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||| ||||||||||||| |||||||||| |||||||| || ||  ||||||||| | ||||||||| |||||    
17987550 tgtcccgtgaacatagctcagttggtaggataatgcattattatatgcaggggccggagttcgaaccccggacaccccaattatt 17987466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 28465613 - 28465661
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||| |||||||||||||||||||||||| ||||||||    
28465613 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcag 28465661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 10199826 - 10199759
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||||||||||||||| |||||||| || || |||||||||| || ||||||||||||||    
10199826 tcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccaaacaccccacttatt 10199759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 44 - 91
Target Start/End: Complemental strand, 41225767 - 41225720
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatg 91  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||||    
41225767 ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatg 41225720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 2696529 - 2696611
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||  |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
2696529 cccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 2696611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 7649521 - 7649606
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||| ||| |||||||||||||||||||| ||||| || ||  | |||||||||| |  ||||||||||||||    
7649521 attgtcccgtgagcatagctcacttggtaggacaatgcattattatatgtag-ggctggggttcgaacctcgaacaccccacttatt 7649606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 10292348 - 10292430
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| ||  ||| |||||||| | |||||||||||||||    
10292348 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctgagattcgaacctcggacaccccacttatt 10292430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 40249982 - 40249932
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||||  |||||||||||||||||||||||| ||||||||    
40249982 ttgtcccgtgagcataactcagttggtaggacaatgcattattatatgcag 40249932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 91
Target Start/End: Original strand, 29108657 - 29108702
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatg 91  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||    
29108657 gtcccgtgagcatagctcagttggtaggacaatgcattattatatg 29108702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 127
Target Start/End: Complemental strand, 35556486 - 35556405
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta 127  Q
    ||||||||||||||| | |||||||||||||||||||||  ||||| || ||| | |||||||||| | ||||||| |||||    
35556486 gtcccgtgagcatagcttagttggtaggacaatgcattagtatatgtaggggttggggttcgaaccccggacacccgactta 35556405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 43875071 - 43874994
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||  ||||||| |||||||||||||||| ||||| || ||  |||||||||||  |||||||||||||||||    
43875071 tgagcataactcagttgataggacaatgcattattatatgtaggggctgaggttcgaacaccagacaccccacttatt 43874994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 24074504 - 24074584
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| || || |||||||||||||||||||||||| ||||| || ||| || ||||||||| | |||||| ||||||||    
24074504 ccgtgatcacagctcagttggtaggacaatgcattattatatgtaggggttgaagttcgaacctcggacacctcacttatt 24074584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 25139988 - 25139904
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||| |||| |||||||| ||| |||||||||||| |||||||| ||||| |||||||||| |  ||| ||||||||||    
25139988 tgtccagtgaacataattcagttgttagaacaatgcattattatatgcaggggtcggggttcgaaccccgaacatcccacttatt 25139904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 44136374 - 44136294
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||  |||||||||||||||||  ||||| |||||||| ||  |||||||||||| |||||||| || |||||    
44136374 ccgtgagcataactcagttggtaggacaatatattattatatgcaggggctgaggttcgaaccccagacacctcaattatt 44136294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 1033060 - 1032978
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||  ||| ||||||||| |||||||||||||| |||||||| |||||  ||||||||| |  ||||||||||||||    
1033060 gtcccgtgagtctagctcagttggtgggacaatgcattattatatgcaggggtcggagttcgaacc-cgaacaccccacttatt 1032978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 1588766 - 1588845
Alignment:
51 gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| | |||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
1588766 gtgagcatagcttagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt 1588845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 10970261 - 10970344
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||| ||||||||||||| |||||||||| |||||||| ||  | ||||| |||| |  ||||||||||||||    
10970261 gtcctgtgagcatagctcagttggtaggataatgcattattatatgcaggggctggggttcaaaccccgaacaccccacttatt 10970344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 50 - 109
Target Start/End: Complemental strand, 26703986 - 26703927
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||  |||||||||||||||||||||||| |||||||  ||||| ||||||||    
26703986 cgtgagcataactcagttggtaggacaatgcattattatatgcaagggtcggggttcgaa 26703927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 38790672 - 38790589
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgagg-ttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||  |||||||| ||| |||||||||||| |||||||| || || || |||||||| |||||||||||||||||    
38790672 cccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccgggggttcgaaccccagacaccccacttatt 38790589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 7540583 - 7540505
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||  ||| |||||||||||||||||||| |||||||| ||||| ||||| ||||   |||| ||||||||||    
7540583 gtgagcataactcacttggtaggacaatgcattattatatgcaggggtcggggttctaaccctggacaacccacttatt 7540505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 111
Target Start/End: Original strand, 8682375 - 8682441
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||||||| ||||||||||||||||| | |||| |||||||| ||| |  |||||||||    
8682375 tgtcccgtgagcatagctcagttggtaggacaattctttattatatgcaggggttggagttcgaacc 8682441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 75 - 129
Target Start/End: Complemental strand, 13702423 - 13702369
Alignment:
75 caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||| ||||| |||||||||| |||||||| ||||||||    
13702423 caatgcattattatatgcaggggtcggggttcgaacctcagacacctcacttatt 13702369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 14012608 - 14012690
Alignment:
48 cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| | |||||||||||| | |||||||| || || ||||||||   | |||||||||||||||    
14012608 cccgtgagcatagttcagttggcagggacaatgcattgttatatgcaggggccggggttcgaagtccggacaccccacttatt 14012690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 29514203 - 29514253
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||| |||||||||| ||||||||||||||||||| |||| ||||||||    
29514203 ttgtcctgtgagcatagctcagttggtaggacaatgctttattatatgcag 29514253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 7314754 - 7314811
Alignment:
72 ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| |||||| |||||||| || ||||||||||||| | |||||||||||||||    
7314754 ggacaatacattattatatgcaggggccgaggttcgaaccccggacaccccacttatt 7314811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 120
Target Start/End: Complemental strand, 21133618 - 21133545
Alignment:
48 cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacacc 120  Q
    ||||||||||||  |||||||| |||| ||||||||||| ||||||||  |||| |||||||||| ||||||||    
21133618 cccgtgagcataactcagttggcaggaacaatgcattattatatgcaggagtcggggttcgaaccccagacacc 21133545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 25689548 - 25689503
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatat 90  Q
    |||||||||||||||| ||||||||| |||||||||||||| ||||    
25689548 tgtcccgtgagcatagctcagttggttggacaatgcattattatat 25689503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 126
Target Start/End: Complemental strand, 26192784 - 26192708
Alignment:
50 cgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||| |||||||||||||||| | | ||||| || |||||||||||||| |||||||||| | ||||||||||||    
26192784 cgtgagcttagttcagttggtagggatattgcat-attatatgcagaggtcggggttcgaaccccggacaccccactt 26192708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 27822063 - 27822148
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| |||| ||||  ||||||||||||| |||||||||| |||||||| ||||  | || ||||| || ||||||||||||||    
27822063 ttgtcctgtgaacataactcagttggtaggataatgcattattatatgcaggggtccggatttgaaccccaaacaccccacttatt 27822148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29937207 - 29937288
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||||||||   ||| ||| | |||||||| || ||  ||||||||| |||||||||||||||||    
29937207 cccgtgagcatagctcagttggtagggacatgtattgttatatgcaggggccggagttcgaacctcagacaccccacttatt 29937288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 109
Target Start/End: Original strand, 31373313 - 31373378
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||||||||| ||||||||||||||| | |||||| ||||| || ||  ||||||||||    
31373313 ttgtcccgtgagcatagctcagttggtaggacattacattattatatgtaggggcagaggttcgaa 31373378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 39432426 - 39432345
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||   ||||| | | |||||||| ||| | |||||||||| |||||||||||||||||    
39432426 cccgtgagcatagctcagttggcagggacatgcaatgttatatgcaggggttggggttcgaacctcagacaccccacttatt 39432345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 110
Target Start/End: Complemental strand, 41089251 - 41089186
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||| ||| |||| | |||||||||||||||||||||| |||||||| ||||| |||| ||||    
41089251 tgtcccgcgagtatagcttagttggtaggacaatgcattattatatgcaggggtcggggtttgaac 41089186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 42761962 - 42761901
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    |||||||||||  |||||||||| ||||||||||||| |||||||| || || |||||||||    
42761962 ccgtgagcataactcagttggtatgacaatgcattattatatgcagggggcggggttcgaac 42761901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 128
Target Start/End: Original strand, 4293904 - 4293960
Alignment:
72 ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    |||||||||||||| |||||||| ||||| |||||||||| |||||| |||| ||||    
4293904 ggacaatgcattattatatgcaggggtcggggttcgaaccccagacatcccatttat 4293960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 129
Target Start/End: Complemental strand, 8740749 - 8740673
Alignment:
53 gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||  |||||||||||||||||||| ||| |||||||| ||  |||||||||||  | ||||||| |||||||    
8740749 gagcataactcagttggtaggacaatgcagtattatatgcaggggctgaggttcgaactccggacaccctacttatt 8740673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 9578098 - 9578050
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggt 98  Q
    ||||||| |||||||||||| || |||||||||||| ||||||||||||    
9578098 cgtgagcttagttcagttggcagaacaatgcattattatatgcagaggt 9578050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 42762111 - 42762047
Alignment:
65 gttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||||||||  |||||||| ||||||||||| || | | |||||||||||||||    
42762111 gttgataggacaatgcattactatatgcaggggtcgaggttcaaatcccggacaccccacttatt 42762047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 8034525 - 8034608
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  || |||  |||||||||||||||| ||||||||  | || |||||||||| |  ||||||||||||||    
8034525 gtcccgtgagcataactccgttaataggacaatgcattattatatgcaggagccggggttcgaaccccgaacaccccacttatt 8034608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 13537383 - 13537328
Alignment:
74 acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| | ||||||||  |||| |||||||||| |||||||||||||||||    
13537383 acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttatt 13537328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 13626931 - 13626876
Alignment:
74 acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| | ||||||||  |||| |||||||||| |||||||||||||||||    
13626931 acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttatt 13626876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Complemental strand, 30942675 - 30942616
Alignment:
70 taggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||| || || |||||||||| |  ||||||||||||||    
30942675 taggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatt 30942616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 44923401 - 44923314
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcatta-taatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||||| ||| ||| || |||||||||||| | |||||||| ||||| |||||||||| | ||| ||||| |||||    
44923401 attgtcccgtcagcatagctcaattgataagacaatgcattatttatatgcaggggtcggggttcgaaccccggactccccatttatt 44923314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 220461 - 220379
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||| |||   ||||| | | |||||||||||||  |||||||| | | |||||||||||||||    
220461 tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt 220379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 689616 - 689534
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||| |||   ||||| | | |||||||||||||  |||||||| | | |||||||||||||||    
689616 tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt 689534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 734084 - 734002
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||| |||   ||||| | | |||||||||||||  |||||||| | | |||||||||||||||    
734084 tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt 734002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 857980 - 857898
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||| |||   ||||| | | |||||||||||||  |||||||| | | |||||||||||||||    
857980 tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt 857898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 107
Target Start/End: Original strand, 7603729 - 7603787
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcg 107  Q
    |||||||||||  | |||| ||||||||||||||||| |||||||| ||||| ||||||    
7603729 ccgtgagcataacttagttcgtaggacaatgcattattatatgcagtggtcggggttcg 7603787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 100
Target Start/End: Complemental strand, 36467984 - 36467930
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcg 100  Q
    |||||||||  |||| |||||||||| ||||||||||||| |||||||| |||||    
36467984 gtcccgtgattatagctcagttggtatgacaatgcattattatatgcaggggtcg 36467930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 86
Target Start/End: Complemental strand, 44361024 - 44360994
Alignment:
56 catagttcagttggtaggacaatgcattata 86  Q
    |||||||||||||||||||||||||||||||    
44361024 catagttcagttggtaggacaatgcattata 44360994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 3379748 - 3379665
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||  ||||||| ||||| |||||||| | |||||||| || |  |||||||||| | |||||||||||||||    
3379748 ttgtcccgtgagcataactcagttgataggataatgcattgttatatgcag-gggctgggttcgaacc-ccgacaccccacttatt 3379665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 22426422 - 22426479
Alignment:
72 ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| ||||| || ||| |||||||||||| | ||||||||| |||||    
22426422 ggacaatgcattattatatgtaggggttgaggttcgaacccctgacaccccatttatt 22426479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 122
Target Start/End: Original strand, 28378806 - 28378883
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc 122  Q
    |||||||||| ||||| ||| ||||||||||||   ||||| |||||||| ||  |||||||||||| | ||||||||    
28378806 tgtcccgtgaacatagctcaattggtaggacaagatattattatatgcaggggctgaggttcgaaccccggacacccc 28378883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 33570503 - 33570446
Alignment:
72 ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| | |||||||  ||||| |||||||||| | |||||||||||||||    
33570503 ggacaatgcattgttatatgcatgggtcggggttcgaacctcggacaccccacttatt 33570446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 35301237 - 35301180
Alignment:
72 ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||| ||||| |||||||||  | ||||||| |||||||    
35301237 ggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctacttatt 35301180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 40329306 - 40329261
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatat 90  Q
    |||||||||||||||| || |||||||| |||||||||||| ||||    
40329306 tgtcccgtgagcatagctcggttggtagaacaatgcattattatat 40329261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 5323919 - 5323982
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||| | ||||||| || ||||||||||||| |||||||| ||||| ||||||||||    
5323919 cccgtgagcatact-cagttggcagtgacaatgcattattatatgcaggggtcggggttcgaacc 5323982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 17110314 - 17110381
Alignment:
62 tcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||||||||||| |||||||| ||||| ||||| |||| | |||| ||||||||||    
17110314 tcagttggtagggacaatgcattattatatgcaggggtcggggttcaaacc-cggacatcccacttatt 17110381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 22847331 - 22847279
Alignment:
77 atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| | |||||||| |||||||||||||||| || ||||| ||||||||    
22847331 atgcattgttatatgcaggggtcgaggttcgaaccccacacacctcacttatt 22847279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 31129301 - 31129380
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||| |||||||| ||| |||||||||||| |||||    ||||| |||||||||| | |||||||||||||||    
31129301 cccgtgatcatagctcagttggcagggacaatgcattattatatgg---ggtcggggttcgaaccccggacaccccacttatt 31129380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 82
Target Start/End: Original strand, 33566954 - 33566990
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcat 82  Q
    ||||||||||||||| ||||||| |||||||||||||    
33566954 gtcccgtgagcatagctcagttgataggacaatgcat 33566990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 40329689 - 40329621
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtc-gaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||||| |||||||  |||| |||||||||| | | ||||||| |||||||    
40329689 tcagttggtaggataatgcattattatatgcatgggtcggaggttcgaatctcggacaccctacttatt 40329621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 100)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 9924849 - 9924934
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||| |||||||||| | ||||| |||||||||    
9924849 ttgtcccgtgagcatagttcagttggtaggacaacgcattattatatgcaggggtcggggttcgaaccccggacactccacttatt 9924934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 47018047 - 47017963
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
47018047 tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 47017963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 56546549 - 56546466
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| ||| |||||||||||||||||||| |||||||| || || |||||||||| |||||||||||||||||    
56546549 gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacagacaccccacttatt 56546466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 32885686 - 32885766
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||||||||||||||||||||||| |||||||| |||||  ||||||||| | |||||||||||||||    
32885686 ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttatt 32885766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 45350270 - 45350354
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||||  ||||||||| | |||||||||||||||    
45350270 tgtcccgtcagcatagctcagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttatt 45350354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 45359749 - 45359833
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||||  ||||||||| | |||||||||||||||    
45359749 tgtcccgtcagcatagctcagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttatt 45359833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 548987 - 548904
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||  ||||||||||||||||||||||| |||||||| || || |||||||| | |||||||||||||||||    
548987 gtcccgtgagcatagcccagttggtaggacaatgcattattatatgcaggggccggggttcgaaactcagacaccccacttatt 548904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 13211452 - 13211369
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||||  ||||| |||||||||| | ||||| |||||||||    
13211452 gtcccgtgagtatagttcagttggtaggacaatgcattattatatgcatgggtcggggttcgaaccccggacactccacttatt 13211369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 34773779 - 34773700
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||| |||||||||||||||| |||||||| ||  |||||||||||| | |||||||||||||||    
34773779 cgtgagcatagttcagttgataggacaatgcattattatatgcaggggctgaggttcgaaccccggacaccccacttatt 34773700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 43115263 - 43115346
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||| ||||| |||||||| ||||||| |||||||| | ||||||||| |||||    
43115263 gtcccgtgagcttagttcagttggtaggacaatgtattattatatgcaggggtcgagattcgaaccccggacaccccatttatt 43115346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 46735072 - 46734986
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||| ||||||||||||||| |||||||| |||||||| | ||| ||||| |||| | |||||||||||||||    
46735072 attgtcccgtgagcatagctcagttggtaggacactgcattattatatgcagggatcggggttcaaacctcggacaccccacttatt 46734986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 46 - 130
Target Start/End: Complemental strand, 9285759 - 9285675
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc-gaggttcgaaccgcagacaccccacttatta 130  Q
    ||||||||||||||| ||| |||||||||||||||||||| |||||||| |||| | |||||||||| ||||||||||||||||||    
9285759 gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcag-ggtctggggttcgaaccccagacaccccacttatta 9285675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 48 - 128
Target Start/End: Original strand, 34106598 - 34106678
Alignment:
48 cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    ||||||||||||| |||||||| |||| ||||||||||| |||||||||||||| |||||||||| ||||||||||||||||    
34106598 cccgtgagcatagctcagttggcaggaacaatgcattattatatgcagaggtcg-ggttcgaaccccagacaccccacttat 34106678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 35909262 - 35909198
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||| ||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||    
35909262 tcccgtgaacatagttcagttggtaggacaatacattattatatgcagaggtcggggttcgaacc 35909198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 9172473 - 9172406
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||||||||  |||||||||||||||||||||||| |||||||| ||||| ||||||||||    
9172473 ttgtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaacc 9172406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 24234174 - 24234091
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||| ||||||||||| |||||||| || || |||| ||||| | |||||||||||||||    
24234174 gtcccgtgagcatagctcagttggtaggtcaatgcattattatatgcaggggccggggtttgaaccccggacaccccacttatt 24234091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 50657875 - 50657958
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||||||||||||||||||| |||||||| ||||  |||||||||  || ||| ||||||||||    
50657875 gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcatggttcgaactccaaacatcccacttatt 50657958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 48968309 - 48968227
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
48968309 cccgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 48968227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 20753227 - 20753142
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||| ||||||||||||| |||||||||| ||||| || || || |||||||||| | |||||| ||||||||    
20753227 ttgtcccgtgagcatagctcagttggtaggaaaatgcattattatatgtaggggccggggttcgaaccccggacaccacacttatt 20753142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 8690212 - 8690292
Alignment:
50 cgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||| | |||||||||||||| |||||||| ||||| |||||||||| | |||||||||||||||    
8690212 cgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt 8690292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 31601800 - 31601884
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||| ||||||||||| |||||| ||||| |||||||| || |||| |||||||| | |||||||||||||||    
31601800 tgtcccgtgagtatagctcagttggtagaacaatgtattattatatgcaggggccgagattcgaaccccggacaccccacttatt 31601884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 38433305 - 38433389
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||| ||||||||||||| |||||||||||||||| ||||| ||  ||||  ||||||||| |||||||||||||||||    
38433305 tgtcctgtgaacatagttcagttgataggacaatgcattattatatgtaggagtcggagttcgaaccccagacaccccacttatt 38433389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 56314759 - 56314839
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||||||| |||||||||||||||||||| |||||||| ||||  |||||||||| | |||||| ||||||||    
56314759 ccgtgatcatagttcaattggtaggacaatgcattattatatgcaggggtcagggttcgaaccacggacaccacacttatt 56314839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 3465578 - 3465661
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||||  |||||||||||||||||||||||| |||||||| || ||  ||||||||| | |||||||||||||||    
3465578 gtcccgtaagcataactcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttatt 3465661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 35031382 - 35031461
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||  | ||||||||||||| |||| | |||| |||||    
35031382 cgtgagcatagctcagttggtaggacaatgcattattatatgcaggagccgaggttcgaaccccagatatcccatttatt 35031461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 52031202 - 52031285
Alignment:
47 tcccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||| |||||||| |||| ||||||||||  |||||||| ||||| |||||||||| |||||||||||||||||    
52031202 tcccgtgagcttagctcagttggcaggaacaatgcattagtatatgcaggggtcggggttcgaaccccagacaccccacttatt 52031285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 3442847 - 3442921
Alignment:
55 gcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| |||||||||||||||||||||||| |||||  | || || |||||||||| |||||||||||||||||    
3442847 gcatagctcagttggtaggacaatgcattattatatgtcggggccggggttcgaaccccagacaccccacttatt 3442921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4722567 - 4722513
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagagg 97  Q
    |||||||||||| ||||| |||||||||||||||||||||||| |||||||||||    
4722567 attgtcccgtgaacatagctcagttggtaggacaatgcattattatatgcagagg 4722513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 15640542 - 15640460
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||  |||||||| || ||||||||||||| |||||||| | ||| |||||||||| |||||||||||||||||    
15640542 cccgtgagcatatctcagttggcagagacaatgcattattatatgcagtgttcggggttcgaacctcagacaccccacttatt 15640460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 28520830 - 28520748
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
28520830 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 28520748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 40150469 - 40150551
Alignment:
48 cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| |||| ||||||||||| |||| ||| ||||| |||||||||| | |||||| ||||||||    
40150469 cccgtgagcatagttcagttggcaggaacaatgcattattatatacaggggtcggggttcgaaccccggacacctcacttatt 40150551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 42411553 - 42411471
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| ||||||||| || |||||||| ||||| |||||||||| | |||||||||||||||    
42411553 cccgtgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt 42411471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 52560760 - 52560842
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| ||| |||||||||||||||||||| |||||||| || || |||||||||| || ||||  ||||||||    
52560760 tcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacatacacttcacttatt 52560842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 53698075 - 53697997
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||| ||||||| |||||||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
53698075 gtgaacatagctcagttgttaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 53697997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 35747576 - 35747499
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||| |||||||||||||| |||||  ||||||| |||||||||||||||  | |||||||||||||||    
35747576 tgagcatagctcaattggtaggacaatgtattattttatgcaggggtcgaggttcgaactccggacaccccacttatt 35747499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 3544529 - 3544449
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||| |||||||||||||||||||||||| ||||||| ||| || |||||||||| | ||| ||| |||||||    
3544529 ccgtgaacatagctcagttggtaggacaatgcattattatatgcaaaggccggggttcgaaccccggactccctacttatt 3544449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 126
Target Start/End: Complemental strand, 5430465 - 5430385
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||||||||||| |||||||||||||||||| ||||| |||||||| |  |  |||||||||| | ||||||||||||    
5430465 gtcccgtgagcatagctcagttggtaggacaatgtattattatatgcagggaccagggttcgaaccccggacaccccactt 5430385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 12856182 - 12856262
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| ||||||||||||| |||||| ||| ||||| || |||||  ||||||||| | |||||||||||||||    
12856182 ccgtgagcatagctcagttggtaggataatgcactattatatgaaggggtcggagttcgaaccccggacaccccacttatt 12856262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21476181 - 21476098
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| ||||||| ||||| | |||||||| |||||||| |||||| ||||||||  | |||| ||||||||||    
21476181 gtcccgtgagcatagctcagttgataggatattgcattattatatgcaggggtcgatgttcgaactccggacatcccacttatt 21476098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 37728939 - 37728998
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    |||||||||||||||||||||||   ||||||||| |||||||| |||||||||||||||    
37728939 gtgagcatagttcagttggtagggatatgcattattatatgcaggggtcgaggttcgaac 37728998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9692958 - 9693040
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| | |||||||||| |||||||| || || |||||||||| | |||||||||||||||    
9692958 cccgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 9693040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 10098125 - 10098203
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||| |||| ||||||||||||||||||| |||||||| || || | |||||||| | |||||||||||||||    
10098125 gtgaacatagctcagctggtaggacaatgcattattatatgcaggggccgggattcgaaccccggacaccccacttatt 10098203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 14149789 - 14149871
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
14149789 cccgtgaccatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 14149871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 130
Target Start/End: Original strand, 20181204 - 20181290
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta 130  Q
    |||| |||||||||||| |||||||||||||||||||| ||| ||||| || ||| | |||||||| | |||||||| || ||||||    
20181204 ttgttccgtgagcatagctcagttggtaggacaatgcagtattatatgtaggggtaggggttcgaatctcagacacctcatttatta 20181290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 26253948 - 26254030
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||||||||||||||| |||||| ||||| |||||||| |||||  ||||||| | | ||||| |||||||||    
26253948 tcccatgagcatagttcagttggtagaacaatgtattattatatgcaggggtcggagttcgaatcccggacactccacttatt 26254030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 27921892 - 27921974
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| ||||||||||||   ||||||||| |||||||| || || |||||||||| |||||| | ||||||||    
27921892 tcccgtgagcatagctcagttggtagggacatgcattattatatgcaggggccggggttcgaaccccagacatctcacttatt 27921974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 34684564 - 34684646
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||| ||||||||  ||| |||||| |||||||||||| |   |||||||| |||||||||||||||||    
34684564 tcccgtgagcataattcaattggtaggggaatacattattatatgcagaggttggaattcgaacctcagacaccccacttatt 34684646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 46799404 - 46799485
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||| ||| |||||||||||| ||||||||| | ||||||||||||| | ||||||||| |||||    
46799404 cccgtgagcatagtttagttggcaggcacaatgcattattatatgcaga-gccgaggttcgaaccccggacaccccatttatt 46799485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 53815692 - 53815774
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| ||  | |||||||||| | |||||||||||||||    
53815692 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttatt 53815774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 109
Target Start/End: Complemental strand, 55266534 - 55266472
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||||||||| ||||||||||| |||||||||||| |||||||| |||||  |||||||    
55266534 tcccgtgagcatagctcagttggtagaacaatgcattattatatgcaggggtcggagttcgaa 55266472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 53 - 122
Target Start/End: Original strand, 5635191 - 5635260
Alignment:
53 gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc 122  Q
    |||||||| ||||||| |||||||||||||||| |||||||| ||||| ||||| |||| | ||||||||    
5635191 gagcatagctcagttgctaggacaatgcattattatatgcaggggtcggggttcaaaccccggacacccc 5635260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 33944463 - 33944398
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||||||  ||||||||||||| |||||||||| |||||||| || || ||||||||||    
33944463 gtcccgtgagcataactcagttggtaggataatgcattattatatgcaggggccggggttcgaacc 33944398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 44074847 - 44074931
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| |||||||| ||||| |||||||||||||||||| |||||||| | | || ||||||| | | |||||||||||||||    
44074847 ttgtcccgcgagcatagctcagt-ggtaggacaatgcattattatatgcagggattgaagttcgaatcccggacaccccacttatt 44074931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 46482918 - 46482869
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||| |||||||||||||||||| |||||| ||||||||    
46482918 tgtcccgtgagcataattcagttggtaggacaatacattattatatgcag 46482869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 50783535 - 50783486
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||||||||||||| ||||||||||||||| |||||||| ||||||||    
50783535 tgtcccgtgagcatagctcagttggtaggacattgcattattatatgcag 50783486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 22751003 - 22751087
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||| ||||| |||||| |||| |||||||| ||||| ||||| |||| |  |||||||| |||||    
22751003 tgtcccgtgagcatagctcagttcgtaggtcaatgcgttattatatgcaggggtcggggttcaaaccccgaacaccccatttatt 22751087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 29269415 - 29269332
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||||||||| |||||||||||||| ||||| || ||  | | |||||||| | |||||||||||||||    
29269415 tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgtaggggctgggattcgaaccccggacaccccacttatt 29269332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 36954131 - 36954215
Alignment:
47 tcccgtgagcatagttca-gttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| ||| ||||| ||| |||||||||||| |||||||| ||||| |||||||||| | ||||||||| |||||    
36954131 tcccgtgagcatagctcaagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttatt 36954215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 95
Target Start/End: Original strand, 46937262 - 46937306
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcaga 95  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||    
46937262 gtgagcatagctcagttggtaggacaatgcattataatatacaga 46937306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 52743222 - 52743270
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    |||||||||||||||| || ||||||||||||||||||||| |||||||    
52743222 tgtcccgtgagcatagctcggttggtaggacaatgcattattatatgca 52743270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 122
Target Start/End: Complemental strand, 534864 - 534789
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc 122  Q
    |||||||||||||| ||| ||||||||||||||||| || |||||||| ||||| |||| ||| | | ||||||||    
534864 tcccgtgagcatagctcaattggtaggacaatgcatcattatatgcaggggtcggggtttgaatcccggacacccc 534789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 6481672 - 6481601
Alignment:
58 tagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||   |||||| || ||||||||||| ||||||||||||| ||||| |||||||||||    
6481672 tagttcagttggcagggacatgcatgattatatgcagaggccgaggttcgaacctcagacgccccacttatt 6481601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 85
Target Start/End: Original strand, 17859769 - 17859812
Alignment:
42 cattgtcccgtgagcatagttcagttggtaggacaatgcattat 85  Q
    |||||||| |||||||||| ||||||||||||||||||||||||    
17859769 cattgtcctgtgagcatagctcagttggtaggacaatgcattat 17859812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 23661458 - 23661375
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||| ||||||| |||||||||||||| | ||||| || ||| | |||||||||| |  ||||||||||||||    
23661458 gtcccgtgaacatagctcagttgctaggacaatgcattgttatatgtaggggtaggggttcgaaccccgaacaccccacttatt 23661375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 49089377 - 49089294
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||| | ||||||||||||||| |||||| |||||||| || ||| ||||||||| | ||||  |||||||||    
49089377 gtcccgtgagcttagcttagttggtaggacaatacattattatatgcaggggccgaagttcgaacccctgacattccacttatt 49089294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 51077878 - 51077945
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||| |||||||| |||||  ||||||| | |  ||||||||||||||    
51077878 tcagttggtaggacaatgcattattatatgcaggggtcggagttcgaatctcgaacaccccacttatt 51077945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 56 - 110
Target Start/End: Original strand, 6053985 - 6054039
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||| |||||||||||||||||||||||| |||||||| || || |||||||||    
6053985 catagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaac 6054039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 9084759 - 9084837
Alignment:
52 tgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||||| ||| |||||||||| | |||||||| ||||| | |||||||| | |||||||||||||||    
9084759 tgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttatt 9084837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 12820504 - 12820422
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| || ||||||||||| | |||||||| ||||| |||| |||||   |||||||||||||||    
12820504 cccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttatt 12820422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 33076528 - 33076608
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| ||||||||  |||| ||||||||| |||||||| ||||| |||||||||| | ||||||| |||||||    
33076528 tcccgtgagcatagctcagttgg-gggac-atgcattattatatgcaggggtcggggttcgaaccccggacaccctacttatt 33076608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 36008271 - 36008353
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||| | |||||||| || || |||||||||| |  ||||||||||||||    
36008271 cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttatt 36008353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 71 - 129
Target Start/End: Complemental strand, 37032254 - 37032196
Alignment:
71 aggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||||||| ||||| | |||||||| | |||||||||||||||    
37032254 aggacaatgcattattatatgcaggggtcgggattcgaaccccggacaccccacttatt 37032196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 128
Target Start/End: Complemental strand, 43606200 - 43606118
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    ||||||||| ||||| ||||||| |||||||||||||||| |||||||| | ||| ||||  || | ||||||||||| ||||    
43606200 gtcccgtgaacatagctcagttgataggacaatgcattattatatgcagggatcggggtttaaatcccagacaccccatttat 43606118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 109
Target Start/End: Original strand, 55345756 - 55345822
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||  ||||||||| ||||||||||||||||||| |||| |||| ||| ||| ||||||||||    
55345756 attgtcctttgagcatagctcagttggtaggacaatgcgttattatatacaggggttgaggttcgaa 55345822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 144
Target Start/End: Original strand, 2565257 - 2565353
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttattagccactaggctacc 144  Q
    ||||||||||||| |||||||  ||| |||||||||| | |||||||| |||||  ||||||| | |  |||||||||||||| ||||||||||||||    
2565257 cccgtgagcatagctcagttgacagggacaatgcattgttatatgcaggggtcggagttcgaatcccgaacaccccacttatt-gccactaggctacc 2565353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 6637823 - 6637739
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||  ||||| |||| ||||| |||||| |||||||| ||| | |||||||||| |  ||||||||||||||    
6637823 ttgtcccgtgagcatagc-cagttcgtagaacaatacattattatatgcaggggttggggttcgaaccccgaacaccccacttatt 6637739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 20166313 - 20166394
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||| |||||||| |||   ||||||| | |||||||| || ||||||||||||| |||| ||||||||||||    
20166313 cccgtgagcgtagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccccagataccccacttatt 20166394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 93
Target Start/End: Complemental strand, 52608661 - 52608620
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    ||||||||| |||||||||||||||||||||||| |||||||    
52608661 tgagcatagctcagttggtaggacaatgcattattatatgca 52608620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 109
Target Start/End: Complemental strand, 6710312 - 6710248
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||| ||||||||| | ||||||| |||||||||||||| |||||||   |||||||||||||    
6710312 tgtcccatgagcatagcttagttggttggacaatgcattattatatgcaagagtcgaggttcgaa 6710248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 20266857 - 20266905
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||| ||| ||| |||||||||||||||||||| ||||||||    
20266857 gtcccgtgagcttagctcatttggtaggacaatgcattattatatgcag 20266905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 35803190 - 35803110
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||| ||| |||||||||||||||||||| |||||||| |  ||| ||||||||    |||||||||||||||    
35803190 ccgtaagcatagctcaattggtaggacaatgcattattatatgcagggaccgaagttcgaactctcgacaccccacttatt 35803110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 40200857 - 40200809
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    |||||||||| ||| | |||||||||||||||||||||||| |||||||    
40200857 tgtcccgtgaacattgctcagttggtaggacaatgcattattatatgca 40200809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 44374175 - 44374131
Alignment:
51 gtgagcatagttcagttggtaggac-aatgcattataatatgcag 94  Q
    ||||||||||||||||||||||||| |||||||||| ||||||||    
44374175 gtgagcatagttcagttggtaggacaaatgcattattatatgcag 44374131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 49319392 - 49319471
Alignment:
50 cgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||| | ||||| |||||||| |||||||| ||||| ||||| |||| | |||||||||||||||    
49319392 cgtgagcatagctcagttggcatggaca-tgcattattatatgcaggggtcggggttccaaccccggacaccccacttatt 49319471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 53291436 - 53291484
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    |||||||||||||||  ||||||||||||| |||||||||| |||||||    
53291436 tgtcccgtgagcataactcagttggtaggataatgcattattatatgca 53291484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 101
Target Start/End: Original strand, 6365323 - 6365374
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcga 101  Q
    ||||||||||   ||||||||||||||||||||||| |||||||| ||||||    
6365323 cgtgagcataacccagttggtaggacaatgcattattatatgcaggggtcga 6365374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 26203883 - 26203804
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||||||||||||||| |||||||| ||||  || ||| | |||| ||||| | |||| ||||||||||    
26203883 cgtgagcatagctcagttggtaggacagtgcattattatataaaggggttggggtttgaacccctgacatcccacttatt 26203804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 47416479 - 47416546
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||| ||||| |||||||| ||| | |||||||| | | |||||||||||||||    
47416479 tcagttggtaggataatggattattatatgcaggggttggggttcgaatctcggacaccccacttatt 47416546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 31578014 - 31578060
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgc 92  Q
    ||||||||| ||||| | |||||||||||||||||||||| ||||||    
31578014 gtcccgtgaacatagctgagttggtaggacaatgcattattatatgc 31578060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 128
Target Start/End: Complemental strand, 56531332 - 56531254
Alignment:
51 gtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    |||||||||| |||||||| | |||||||||||| | |||||||| || || |||||||||  | ||||||||||||||    
56531332 gtgagcatagctcagttggcaaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccccacttat 56531254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 438479 - 438430
Alignment:
46 gtcccgtgagcatagttcagttggtaggac-aatgcattataatatgcag 94  Q
    ||||||||||||||| ||||||||||| || |||||||||| ||||||||    
438479 gtcccgtgagcatagctcagttggtagaacaaatgcattattatatgcag 438430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 80 - 129
Target Start/End: Complemental strand, 7768854 - 7768805
Alignment:
80 cattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| ||||||||||| || |||||||||| | |||||||||||||||    
7768854 cattattatatgcagaggccggggttcgaaccccggacaccccacttatt 7768805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 33536226 - 33536283
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||| | |||||||| |||||||||||||  |||| || ||||||||||||||    
33536226 tgagcatagctaagttggtaagacaatgcattattttatgtaggggtcgaggttcgaa 33536283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 41492596 - 41492516
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||   ||||||||| |||||||| || || ||||||||||   |||||||||||||||    
41492596 cccgtgagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaacc-tggacaccccacttatt 41492516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 49743359 - 49743440
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||||||||||||||| |||   ||||||||| |||||||| || || | |||||||| | |||||| ||||||||    
49743359 cccgcgagcatagttcagttggcagggatatgcattattatatgcaggggccgggattcgaaccccggacacctcacttatt 49743440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 12868126 - 12868078
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||| ||||||||  | |||||||||||||||||||||| ||||||||    
12868126 gtcccttgagcataacttagttggtaggacaatgcattattatatgcag 12868078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 26708636 - 26708569
Alignment:
62 tcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||||||||||| |||||||| ||| | |||||||||| |||||||| ||| ||||    
26708636 tcagttggtagggacaatgcattattatatgcaggggttg-ggttcgaacctcagacacctcacctatt 26708569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 129
Target Start/End: Complemental strand, 35230388 - 35230312
Alignment:
53 gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| ||||||||||||   |||||||   |||||||  ||||| |||||||||| | |||||||||||||||    
35230388 gagcatagctcagttggtagggatatgcattgctatatgcatgggtcggggttcgaacctcggacaccccacttatt 35230312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 44272935 - 44273014
Alignment:
50 cgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||| |||||||| ||||| |||||||| |||||||| |||||  ||||||||| | || ||||||||||||    
44272935 cgtgaacatagtttagttggtatggaca-tgcattattatatgcaggggtcggagttcgaacctcggataccccacttatt 44273014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 55656208 - 55656160
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||  ||||||||| ||||||| |||||| ||||||||    
55656208 gtcccgtgagcataactcagttggttggacaatacattattatatgcag 55656160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 74)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 33800888 - 33800971
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||||| || || |||||||||| |||||||||||||||||    
33800888 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt 33800971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 18872517 - 18872599
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| |  ||||||||||||||    
18872517 tcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttatt 18872599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 19059105 - 19059021
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| |||||||||||||||||||||||| |||||||| || || ||||||||||   |||||||||||||||    
19059105 tgtcccgtgagcatagctcagttggtaggacaatgcattatcatatgcaggggccggggttcgaaccctggacaccccacttatt 19059021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 1244828 - 1244744
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| ||||||||||  ||||||||||||||| ||||||| |||||||| ||||  |||||||||| |||||||||||||||||    
1244828 tgtcctgtgagcatagcacagttggtaggacaaagcattattatatgcaggggtcagggttcgaaccccagacaccccacttatt 1244744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 27440392 - 27440333
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||    
27440392 tgagcatagctcagttggtaggacaatgcattattatatgcagtggtcgaggttcgaacc 27440333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 29106138 - 29106055
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||| ||| |||||||||||||||||||| |||||||| || ||| |||||||||  ||||||||||||||||    
29106138 gtcctgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaagttcgaaccctagacaccccacttatt 29106055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 29841347 - 29841426
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| |||||||  || |||| |||||||| | |||||||||||||||    
29841347 cgtgagcatagctcagttggtaggacaatgcattattatatgcaagggccgagattcgaaccccggacaccccacttatt 29841426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 843469 - 843385
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||  |||||||||| ||||||||||||| ||||| || || || |||||||||| | |||||||||||||||    
843469 tgtcccgtgagcatatctcagttggtatgacaatgcattattatatgtaggggacggggttcgaaccccggacaccccacttatt 843385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 32158515 - 32158431
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| ||| ||| |||||||||||||||||||| |||||||| || || |||||||||| |  ||||||||||||||    
32158515 tgtcccgtgagcttagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatt 32158431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 33729772 - 33729856
Alignment:
46 gtcccgtgagcat-agttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |  |||||||||||||||||||||||| |||||||| || || |||||||| | |||||||||||||||||    
33729772 gtcccgtgagcattaactcagttggtaggacaatgcattattatatgcaggggccggggttcgaatctcagacaccccacttatt 33729856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 129
Target Start/End: Complemental strand, 2411386 - 2411311
Alignment:
54 agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| |||||||||||||||||| ||||| |||||||| || ||  ||||||||| |||||||||||||||||    
2411386 agcatagctcagttggtaggacaatgtattattatatgcaggggccggagttcgaaccccagacaccccacttatt 2411311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 18478002 - 18478081
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||||||||||||||||||| |||||| | || || ||||||||||   |||||||||||||||    
18478002 cgtgagcatagctcagttggtaggacaatgcattattatatgctggggccggggttcgaaccctggacaccccacttatt 18478081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 42 - 129
Target Start/End: Complemental strand, 20945995 - 20945908
Alignment:
42 cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||  ||| |||||||||||||||||||| |||||||| || || ||||||||   | |||||||||||||||    
20945995 cattgtcccgtgagcataactcaattggtaggacaatgcattattatatgcaggggccggggttcgaaatccggacaccccacttatt 20945908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 22600035 - 22599953
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||||| ||| | | || ||||| |||||||||||||||||    
22600035 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcag-ggttgggatttgaaccccagacaccccacttatt 22599953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 24205435 - 24205513
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||||||||||||||||||||| | ||||| || |||| ||||||||||| | |||||||||||||||    
24205435 cgtgaacatagttcagttggtaggacaatgcattgttatatgtaggggtc-aggttcgaaccccggacaccccacttatt 24205513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 40339201 - 40339134
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||||||||| |||||| ||||||||||||||||| |||||||| || || ||||||||||    
40339201 ttgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaacc 40339134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 29096403 - 29096325
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| |||||||||||||||||||||||| |||||||  || ||  ||||||||| | |||||||||||||||    
29096403 gtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggagttcgaaccccggacaccccacttatt 29096325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 4674912 - 4674832
Alignment:
50 cgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||  ||| |||||||||||| |||||||| ||||| |||||||||| | |||||||||||||||    
4674912 cgtgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt 4674832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 1463870 - 1463949
Alignment:
51 gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
1463870 gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 1463949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 2029228 - 2029145
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  | |||||||||||||||| ||||| |||||||| ||||| | |||||||| |  ||||||||||||||    
2029228 gtcccgtgagcataacttagttggtaggacaatgtattattatatgcaggggtcgggattcgaaccccgaacaccccacttatt 2029145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 109
Target Start/End: Complemental strand, 4666546 - 4666483
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    ||||||||||||||| ||| ||||||| |||||||||||| |||||||  ||||||||||||||    
4666546 gtcccgtgagcatagctcaattggtagaacaatgcattattatatgcaagggtcgaggttcgaa 4666483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 6447580 - 6447497
Alignment:
47 tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||  |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
6447580 tcccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt 6447497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 6614138 - 6614055
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||| |||||||  |||| |||||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
6614138 gtcccgcgagcataactcagctggtagaacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt 6614055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 7234956 - 7234889
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| |||||||||||||||||| ||||| |||||||| |||||||||| |||| |||||| |||||    
7234956 tcagtcggtaggacaatgcattattatatgtagaggtcggggttcgaaccccagataccccatttatt 7234889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 47 - 98
Target Start/End: Complemental strand, 7645201 - 7645150
Alignment:
47 tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggt 98  Q
    |||||||||||||| | |||||||||||||||||||||| ||||||||||||    
7645201 tcccgtgagcatagcttagttggtaggacaatgcattattatatgcagaggt 7645150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 8015830 - 8015913
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  ||||| ||||||| |||||||||| | |||||| || || |||||||||| | |||||||||||||||    
8015830 gtcccgtgagcatatctcagtcggtaggataatgcattattacatgcaggggccggggttcgaaccccggacaccccacttatt 8015913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 27219663 - 27219580
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| | |||||||||||||||||||||| |||||||  || || ||||| |||| |  ||||||||||||||    
27219663 gtcccgtgagcatagcttagttggtaggacaatgcattattatatgcatgggccggggttcaaaccccgtacaccccacttatt 27219580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 29144153 - 29144220
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||||| |||||||| ||||| |||| ||||  ||||||||||| |||||    
29144153 tcagttggtaggacaatgcattattatatgcaggggtcggggtttgaactccagacaccccatttatt 29144220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 29266063 - 29266146
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| ||| ||| |||||||||||||||| |||||||| ||||   ||||||||  |||||||| ||||||||    
29266063 gtcccgtgagcatagctcaattgataggacaatgcattattatatgcaggggtcagagttcgaacatcagacaccacacttatt 29266146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 36045234 - 36045151
Alignment:
47 tcccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||| |||||||  | || ||||||||||| |||||||| ||||| |||||||||| | |||||||||||||||    
36045234 tcccgtgagcatagctcagttgacaagaacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt 36045151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 37303930 - 37304012
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||| ||||| |||||||| ||||| ||||||||||   |||||||||||||||    
37303930 cccgtgagcatagctcagttggcagggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccacttatt 37304012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 123
Target Start/End: Original strand, 29050795 - 29050872
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccca 123  Q
    |||||| |||||||| |||||||||||||||||||||||| |||||||| || || |||| ||||  | |||||||||    
29050795 gtcccgcgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggtttgaactccggacacccca 29050872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 10508574 - 10508658
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| ||||| |||||||||||||||||| ||||| |||||||| || |  |||||||| |   |||||||||||||||    
10508574 tgtcccgtgaacatagctcagttggtaggacaatgtattattatatgcaggggccacggttcgaaacctggacaccccacttatt 10508658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 13754000 - 13754084
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| | ||||  ||||||||||||||||| |||||| |||||||| |||||| ||||||||  | ||||||||| |||||    
13754000 tgtcccgtaaacataactcagttggtaggacaatacattattatatgcaggggtcgatgttcgaacgtcggacaccccatttatt 13754084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 14487559 - 14487639
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||| ||||||||||||||||||||||||| ||||| || ||| | |||||||||| | || | ||||||||||    
14487559 ccgtgaggataattcagttggtaggacaatgcattattatatgtaggggttggggttcgaacctcggatatcccacttatt 14487639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 26302590 - 26302511
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| || ||||||||||||||||||||| |||| ||| || ||  ||||||||| | |||||||||||||||    
26302590 ccgtgagcatagctcggttggtaggacaatgcattattatatacag-ggccggagttcgaacctcggacaccccacttatt 26302511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 31934972 - 31934912
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||| ||||  |||||||||||||||||||||||| |||||||||| | ||||||||||    
31934972 ccgtgaacataactcagttggtaggacaatgcattattatatgcagagattgaggttcgaa 31934912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 36888193 - 36888145
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||  |||||||||||||||||||||||| ||||||||    
36888193 gtcccgtgagcatatctcagttggtaggacaatgcattattatatgcag 36888145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 129
Target Start/End: Complemental strand, 42455483 - 42455411
Alignment:
57 atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||||||||||||||||| |||||||| || ||  ||||||||| | ||||| |||||||||    
42455483 atagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacactccacttatt 42455411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 42595735 - 42595819
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||| ||||||||||||| |||||| |||||||| |  || |||| ||||| |  ||||||||||||||    
42595735 tgtcccgtgagcatagctcaattggtaggacaatacattattatatgcagggaccggggtttgaaccccgaacaccccacttatt 42595819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 111
Target Start/End: Original strand, 9577295 - 9577362
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||| |||  |||||||||||||||||||||||| |||||||  || || ||||||||||    
9577295 ttgtcccgtgagtataactcagttggtaggacaatgcattattatatgcatgggccggggttcgaacc 9577362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21017706 - 21017623
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| ||||| |||||||||||||||||||||||| ||||| || ||  | |||| ||||| | |||| ||||||||||    
21017706 gtcccgtgaacatagctcagttggtaggacaatgcattattatatgtagtggctggggtttgaaccccggacatcccacttatt 21017623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 23925542 - 23925621
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||  ||||||| |||||||||||||||| |||||||| ||||  |||||||| | | || ||||||||||||    
23925542 cgtgagcataactcagttgataggacaatgcattattatatgcaggggtctgggttcgaatcccggataccccacttatt 23925621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 64 - 130
Target Start/End: Complemental strand, 973058 - 972992
Alignment:
64 agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta 130  Q
    |||||||||||||||||||||| |||| ||| || || |||||||||| | ||| ||||||||||||    
973058 agttggtaggacaatgcattattatatacaggggccggggttcgaaccccggaccccccacttatta 972992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 6806739 - 6806657
Alignment:
48 cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| || ||||||||||| | |||||||| ||||| | |||||||| | ||||| |||||||||    
6806739 cccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcgggattcgaaccccggacactccacttatt 6806657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7147117 - 7147036
Alignment:
48 cccgtgagcatagttcagttggt-aggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||||| ||||| ||||||||| |||||||| ||||| |||||||||| | |||||| || |||||    
7147117 cccgtgagcatagctcagttggtaaggac-atgcattattatatgcaggggtcggggttcgaacctctgacacctcatttatt 7147036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 100
Target Start/End: Original strand, 4793965 - 4794018
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcg 100  Q
    ||||||||||||| ||| |||||||| ||||||||||||||||||||| |||||    
4793965 cccgtgagcatagctcaattggtagggacaatgcattataatatgcaggggtcg 4794018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 22863770 - 22863811
Alignment:
52 tgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    |||||| ||||||||||||||||||||||||||| |||||||    
22863770 tgagcacagttcagttggtaggacaatgcattattatatgca 22863811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 23648328 - 23648388
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||||||||  ||||||||||||||||||||||| |||||||||  | |||||||||||    
23648328 ccgtgagcatagg-cagttggtaggacaatgcattattatatgcagaaattgaggttcgaac 23648388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 23810244 - 23810184
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac 110  Q
    ||||||||||||  ||||||||||||||||||||||| |||||||||  | |||||||||||    
23810244 ccgtgagcatagg-cagttggtaggacaatgcattattatatgcagaaattgaggttcgaac 23810184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 25660909 - 25660990
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| |||   ||||||| | |||||||| || || | |||||||| |||||||||||||||||    
25660909 cccgtgagcatagctcagttggcagggatatgcattgttatatgcaggggccgggattcgaaccccagacaccccacttatt 25660990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 34010534 - 34010595
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||| |||||||||||||||||||||||||||||| ||||  || |||||  |||||||||    
34010534 cgtgaacatagttcagttggtaggacaatgcattattatatataggggtcggagttcgaacc 34010595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 9176886 - 9176838
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||||||||||||  |||||||| ||||||||||||||| ||||||||    
9176886 gtcccgtgagcataactcagttggaaggacaatgcattattatatgcag 9176838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 20699526 - 20699443
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| ||||| ||||| |||||||||||||||||||||||| |||||| | ||  || ||||||| | | |||||||||||||||    
20699526 tgtctcgtgaccatagctcagttggtaggacaatgcattattatatgc-ggggctgaagttcgaaactcggacaccccacttatt 20699443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 129
Target Start/End: Complemental strand, 27025534 - 27025446
Alignment:
42 cattgtcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||||| ||| ||||  || |||||||||| | |||| ||| || |  |||||||||| |||||||||||||||||    
27025534 cattgtcccgtgagcatagctcatttggccgggacaatgcattgttatattcaggggcctgggttcgaaccccagacaccccacttatt 27025446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 128
Target Start/End: Complemental strand, 37684576 - 37684536
Alignment:
88 tatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    |||||||||||||||||||||||  ||||||||||||||||    
37684576 tatgcagaggtcgaggttcgaactccagacaccccacttat 37684536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 43404377 - 43404425
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    ||||| ||||||||| ||||||||||||||||||||||||  |||||||    
43404377 gtcccttgagcatagctcagttggtaggacaatgcattattgtatgcag 43404425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 126
Target Start/End: Original strand, 4067982 - 4068060
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt 126  Q
    ||||||||| ||| |||||||||||| ||||||||| ||  ||||||| || ||||||||||||| | ||||||||||||    
4067982 cccgtgagcttagctcagttggtagggacaatgcat-attttatgcagggggcgaggttcgaaccccggacaccccactt 4068060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 29329018 - 29329065
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    ||||||||||||||| |||||||||| || |||||||||| |||||||    
29329018 gtcccgtgagcatagctcagttggtaagataatgcattatcatatgca 29329065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 30403749 - 30403828
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||  ||||||||||||||||| |||||| |||| ||| || ||  ||| ||||| | |||||||||||||||    
30403749 cgtgagcataactcagttggtaggacaatacattattatatacaggggccggagtttgaaccccggacaccccacttatt 30403828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 42618513 - 42618430
Alignment:
47 tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||  |||||||| ||| |||||||||||| |||| ||| ||||| |||||||| | | || ||||||||||||    
42618513 tcccgtgagcatacctcagttggcagggacaatgcattattatatacaggggtcggggttcgaatcccggataccccacttatt 42618430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 129
Target Start/End: Original strand, 10943740 - 10943794
Alignment:
75 caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| |||||||| || || |||||||||| | |||||||||||||||    
10943740 caatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt 10943794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 20735274 - 20735192
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||| ||||| |||||||| ||| |||||||||||| ||||| || || || |||||||| | | |||||||||||||||    
20735274 cccgtgaacatagctcagttggcagggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccacttatt 20735192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 42070654 - 42070604
Alignment:
43 attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    ||||||| || ||||||| ||||||||||| |||||||||||| |||||||    
42070654 attgtcctgtaagcatagctcagttggtagaacaatgcattattatatgca 42070604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 3536034 - 3535953
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||||||||| |||   ||||||| | |||| |||  | || |||||||||| | |||||||||||||||    
3536034 cccgtgagcatagttcagttggcagggacatgcattgttatatacaggagccggggttcgaaccccggacaccccacttatt 3535953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 129
Target Start/End: Complemental strand, 15978759 - 15978694
Alignment:
64 agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||||||| ||||| ||||| || ||  |||||| ||||| || ||||||||||||||    
15978759 agttggtaggacaatgtattattatatgtaggggatgaggtttgaaccccaaacaccccacttatt 15978694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 20186864 - 20186942
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| | |||||||| |||   ||||||||| |||||||| ||||| ||||  |||| |||||||||||||||||    
20186864 ccgtgagcattgctcagttggcagggacatgcattattatatgcaggggtcggggtt--aaccccagacaccccacttatt 20186942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 24653136 - 24653220
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||||  |||||||| | ||| ||||||||| |||||||| ||| | ||||||||   ||||||| |||||||||    
24653136 ttgtcccgtgagcataactcagttggcaagac-atgcattattatatgcaggggttggggttcgaatttcagacactccacttatt 24653220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 26169096 - 26169047
Alignment:
62 tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||||||||||||||| |||||||| ||| |  |||||||||    
26169096 tcagttggtaggacaatgcattattatatgcaggggttggagttcgaacc 26169047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 96
Target Start/End: Original strand, 30394569 - 30394614
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagag 96  Q
    |||||| ||| |||||||||||||||||||||||| || |||||||    
30394569 gtgagcttagctcagttggtaggacaatgcattattatttgcagag 30394614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 70 - 111
Target Start/End: Complemental strand, 33141865 - 33141824
Alignment:
70 taggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    |||||||||||||||| ||||||||  |||||||||||||||    
33141865 taggacaatgcattattatatgcaggagtcgaggttcgaacc 33141824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 11246591 - 11246511
Alignment:
49 ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||||||| |||   ||||||| | |||||||| ||||| || || |||| |||||| ||||||||||    
11246591 ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggctcaaaccccagacatcccacttatt 11246511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 29630046 - 29629962
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||| |||||| | | ||| |||||||||||||||| ||||| || ||| ||| ||||||||   |||||| ||||||||    
29630046 tgtcccgtgggcatagcttaattgataggacaatgcattatcatatgtaggggttgagattcgaaccctggacacctcacttatt 29629962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 128
Target Start/End: Complemental strand, 37553955 - 37553915
Alignment:
88 tatgcagaggtcgaggttcgaaccgcagacaccccacttat 128  Q
    |||||||||| ||||||||||||  ||||||||||||||||    
37553955 tatgcagaggccgaggttcgaactccagacaccccacttat 37553915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1086 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: scaffold1086
Description:

Target: scaffold1086; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 2483 - 2566
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||  |||||||||||||||||||||||| |||||||||||| || ||| ||||| | |||||||||||||||    
2483 gtcccgtgagcataactcagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttatt 2566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0178 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0178
Description:

Target: scaffold0178; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 4322 - 4401
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||| ||||||| ||||||||| |||||| |||||||| ||||| |||||||||| | ||||| |||||||||    
4322 cgtgagcatagctcagttgataggacaatacattattatatgcaggggtcggggttcgaaccccggacactccacttatt 4401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 101826 - 101909
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||||| |||| |||||||| |||||||||| |||||||| || || |||||||||| || ||| ||||||||||    
101826 gtcccgtgagcatagctcagctggtaggataatgcattattatatgcaggggccggggttcgaaccccaaacatcccacttatt 101909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0765 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0765
Description:

Target: scaffold0765; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 738 - 822
Alignment:
45 tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| || ||||||||||||||| |||||||||||||||| |||||| ||||  |||||||||||    |||||||||||||||    
738 tgtcctgtaagcatagttcagttgataggacaatgcattattatatgcggaggctgaggttcgaactctggacaccccacttatt 822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0191 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0191
Description:

Target: scaffold0191; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 129
Target Start/End: Original strand, 16849 - 16924
Alignment:
53 gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| |  |||||| |||||||    
16849 gagcatagctcagttggtaggacaatgcattattatatgcaggggtcg-ggttcgaaccccgaacaccctacttatt 16924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 185612 - 185529
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||| |||||||||| ||||||||||||||||  |||||| |||||||| || ||||||| ||||| || ||| ||||||||||    
185612 gtcctgtgagcatagctcagttggtaggacaaaacattattatatgcaggggccgaggtttgaaccccaaacatcccacttatt 185529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1990 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1990
Description:

Target: scaffold1990; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 894 - 972
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| | ||| |||||||||||||||||||| |||||||| ||  | |||||||| | |||||||||||||||||    
894 gtgagcatcgctcacttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttatt 972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0308 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0308
Description:

Target: scaffold0308; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 7072 - 7154
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||| |||| |||||||||||| |||||||| || || |||||||||| | ||||||||| |||||    
7072 cccgtgagcatagctcagttgttagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccatttatt 7154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 47412 - 47334
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||| | ||| |||||||||||||||||||| |||||||| ||  | |||||||| | |||||||||||||||||    
47412 gtgagcatcgctcacttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttatt 47334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 25022 - 25104
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| ||  | |||||||||| | |||||||||||||||    
25022 cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttatt 25104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0334 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0334
Description:

Target: scaffold0334; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 5297 - 5381
Alignment:
44 ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||| || |||||||| ||| |||||||||||||||||||| |||||||| || ||  ||||||||| | |||||||||||||||    
5297 ttgtcgcgcgagcatagctcaattggtaggacaatgcattattatatgcaggggccg-tgttcgaaccccggacaccccacttatt 5381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 43791 - 43748
Alignment:
51 gtgagcatagttcagttggtaggacaatgcattataatatgcag 94  Q
    |||||||||| |||||||||||||||||||||||| ||||||||    
43791 gtgagcatagctcagttggtaggacaatgcattattatatgcag 43748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0809 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0809
Description:

Target: scaffold0809; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 4904 - 4823
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||| | | |||||||||||||||    
4904 cccgtgagcatagctcagttggcagggacaatgcattattatatgcag-gggcggggttcgaatcccggacaccccacttatt 4823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0262 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0262
Description:

Target: scaffold0262; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 87 - 129
Target Start/End: Original strand, 2577 - 2619
Alignment:
87 atatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||||| |||||||||| |||||||||||||||||||    
2577 atatgcagaggttgaggttcgaatcgcagacaccccacttatt 2619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0112 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0112
Description:

Target: scaffold0112; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 18030 - 17948
Alignment:
48 cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||| |||||||| |||||||||| | |||||||| ||  | |||||||||| ||||||| |||||||||    
18030 cccgtgagcatagctcaattggtagggacaatgcattgttatatgcaggggctggggttcgaaccccagacactccacttatt 17948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 112
Target Start/End: Original strand, 159009 - 159075
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccg 112  Q
    ||||| ||||||||  |||||||||||||||||||||||| |||||||| || || | |||||||||    
159009 gtcccatgagcataactcagttggtaggacaatgcattattatatgcaggggccgggtttcgaaccg 159075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0533 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0533
Description:

Target: scaffold0533; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 109
Target Start/End: Original strand, 9331 - 9384
Alignment:
56 catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa 109  Q
    |||||||||||| ||||||||||||||||| | |||||| ||||| ||||||||    
9331 catagttcagttagtaggacaatgcattattacatgcaggggtcggggttcgaa 9384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 1036 - 1117
Alignment:
48 cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    ||||||||||||| ||||||||||||   |||||| || ||||| || ||  | |||||||||| |||||||||||||||||    
1036 cccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttatt 1117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 41862 - 41801
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||||||||| |||||||||||||||||| ||| | |||||||| ||||| | ||||||||    
41862 cgtgagcatagctcagttggtaggacaatggattgttatatgcaggggtcgggattcgaacc 41801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 12564 - 12643
Alignment:
51 gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt 129  Q
    |||||||||| |||||||| ||| |||||||||||| |||||||| ||||  |||||||||| | || |||||| |||||    
12564 gtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcagggttcgaacctcggataccccatttatt 12643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Complemental strand, 109030 - 108983
Alignment:
46 gtcccgtgagcatagttcagttggtaggacaatgcattataatatgca 93  Q
    ||||||| ||||||||||| ||||||| |||||||||||| |||||||    
109030 gtcccgtaagcatagttcacttggtagaacaatgcattattatatgca 108983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0062
Description:

Target: scaffold0062; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 7114 - 7053
Alignment:
50 cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc 111  Q
    ||||| ||||| |||| ||||||||||||||||||| |||||||| ||  | ||||||||||    
7114 cgtgaacatagctcagctggtaggacaatgcattattatatgcaggggcgggggttcgaacc 7053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University