View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2049_low_10 (Length: 212)
Name: NF2049_low_10
Description: NF2049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2049_low_10 |
 |  |
|
| [»] scaffold1086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0765 (1 HSPs) |
 |  |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold1990 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0533 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 83)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 30 - 199
Target Start/End: Original strand, 11067418 - 11067587
Alignment:
| Q |
30 |
ataaagtcaggtcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||||||||||||||||||||| | ||||||||||||| ||||||||||||||||| | ||||||||||||||| ||||||||||||||| |
|
|
| T |
11067418 |
ataaagttaggtcattgtcccgtgagcataacttagttggtaggacagtgcattataatatgcaggagccgaggttcgaaccgcggacaccccacttatt |
11067517 |
T |
 |
| Q |
130 |
agccactaggctacctgacctaagnnnnnnnngtcgcgtcattattattttatcattaaagttgttagtg |
199 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11067518 |
agccactaggctacctgaccaaaaaaaaaaaaatcgcgtcattattattttatcattaaagttgttagtg |
11067587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 21884570 - 21884653
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
21884570 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttatt |
21884653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 23930645 - 23930561
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||| ||||||||| ||||| |
|
|
| T |
23930645 |
tgtcccgtgagcatagttcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccctggacaccccatttatt |
23930561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 49251496 - 49251412
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
49251496 |
tgtcctgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttatt |
49251412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 43 - 126
Target Start/End: Complemental strand, 23464089 - 23464006
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||| |
|
|
| T |
23464089 |
attgtcccatgagcatagttcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccactt |
23464006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 15774415 - 15774329
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| || ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
15774415 |
attgtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttatt |
15774329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 4354208 - 4354122
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |||||||| || || ||||||||| | ||||||||||||||| |
|
|
| T |
4354208 |
attgtcctgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacttcggacaccccacttatt |
4354122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 46 - 148
Target Start/End: Original strand, 43092148 - 43092250
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttattagccactaggctacct |
145 |
Q |
| |
|
||||| |||||||| ||| ||||||||| ||| |||||| |||||||| ||||| |||||||||| | ||||||| |||||||||||||||||||| || |
|
|
| T |
43092148 |
gtcccatgagcataactcaattggtaggataatacattattatatgcaggggtcggggttcgaacctcggacacccaacttattagccactaggctatct |
43092247 |
T |
 |
| Q |
146 |
gac |
148 |
Q |
| |
|
||| |
|
|
| T |
43092248 |
gac |
43092250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 538430 - 538346
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||| || || ||||||||| | |||||||||||||| |
|
|
| T |
538430 |
tgtcccgtgagcatagttcagttggtagaacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttatt |
538346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 18923986 - 18923902
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| | || |||||||||| | |||||||||| |||| |
|
|
| T |
18923986 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcagggttcagggttcgaacctcggacaccccacgtatt |
18923902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 38020048 - 38019964
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcg-aaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| || || ||||| |||| ||||||||||||||||| |
|
|
| T |
38020048 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaaccccagacaccccacttatt |
38019964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 39433352 - 39433436
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| |||||||||||||||||||| || |||||||||| |||||||| || ||| ||||||||| | ||||||||||||||| |
|
|
| T |
39433352 |
tgtcccatgagcatagttcagttggtatgaaaatgcattattatatgcaggggccgatgttcgaacctcggacaccccacttatt |
39433436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 24661977 - 24662060
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||||| |||| | |||||||| ||||||||||| ||||| |
|
|
| T |
24661977 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggtcaggattcgaaccccagacaccccatttatt |
24662060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 27745149 - 27745235
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||||||||| |||||||| | ||| |||||||||| | ||||||||| ||||| |
|
|
| T |
27745149 |
attgtcccgtgagcatagctcatttggtaggaaaatgcattattatatgcagggatcggggttcgaaccccggacaccccatttatt |
27745235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29491466 - 29491548
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
29491466 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
29491548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 37733755 - 37733833
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
37733755 |
gtgaacatagctcagttggtaggacaatgcattattatatgcagtggacggggttcgaaccccggacaccccacttatt |
37733833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 39238712 - 39238794
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || ||||||||||||| | ||||||||||||||| |
|
|
| T |
39238712 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttatt |
39238794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 37490883 - 37490968
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| || || ||| |||||| | |||||||| |||||| |
|
|
| T |
37490883 |
ttgtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccggggtacgaaccacggacaccccgcttatt |
37490968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 30649087 - 30649171
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| || ||||||| |||||||| ||||||| |||||||| || | |||||||||| ||||||||||||||||| |
|
|
| T |
30649087 |
tgtcccgtgagcaaagctcagttgataggacaacgcattattatatgcaggagttggggttcgaaccccagacaccccacttatt |
30649171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 42831941 - 42832025
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||||| || | ||||| |||| | ||||||||||||||| |
|
|
| T |
42831941 |
tgtcccgtgagcatagctcagttggtaggacattgcattattatatgcaggggctggggttcaaaccccggacaccccacttatt |
42832025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 43555975 - 43555891
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||| |||||||| | ||| ||||| |||| ||||||||||||||| |
|
|
| T |
43555975 |
tgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcagggatcggggttcaaacccaggacaccccacttatt |
43555891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 46116275 - 46116191
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| |||||||| || | |||||||||| | ||||||||| ||||| |
|
|
| T |
46116275 |
tgtcccgtgagcatagcttagttggtaggacaatgcattatcatatgcaggggctggggttcgaaccccggacaccccaattatt |
46116191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 3533073 - 3532991
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| ||||| || ||||| ||||| |||| | ||||||||||||||| |
|
|
| T |
3533073 |
gtcccgtgagcatagctcagttagtaggacaatgcattattatatgtaggggtcg-ggttccaaccccggacaccccacttatt |
3532991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 45 - 128
Target Start/End: Complemental strand, 9408715 - 9408632
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| | |||||| ||||| ||||||| | | |||| ||||||||| |
|
|
| T |
9408715 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattaaatgcaggggtcggagttcgaatcccggacaacccacttat |
9408632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 15368816 - 15368883
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
15368816 |
tcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
15368883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 4429579 - 4429517
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||| ||| | |||||||||| |
|
|
| T |
4429579 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggttggggttcgaacc |
4429517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 128
Target Start/End: Complemental strand, 2052781 - 2052700
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
2052781 |
cccgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttat |
2052700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 41833633 - 41833552
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcaga-ggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| ||||| ||| ||||| |||||||||| | |||||||||||||| |
|
|
| T |
41833633 |
ccgtgagcatagttcaattggtatgacaatgcattattatatgtagagggtcggggttcgaaccccgaacaccccacttatt |
41833552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 5172706 - 5172654
Alignment:
| Q |
42 |
cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
5172706 |
cattgtcccgtgagcatagctcagttgataggacaatgcattattatatgcag |
5172654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 121
Target Start/End: Complemental strand, 8261772 - 8261700
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccc |
121 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |||||||| ||||| ||||| || | ||||||||| |
|
|
| T |
8261772 |
ccgtgagcatagctcagttggtaggataatgcattattatatgcaggggtcggggttccaatcccagacaccc |
8261700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 17056961 - 17056897
Alignment:
| Q |
65 |
gttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||||| |||||||| || || |||||||||| ||||| ||||||||||| |
|
|
| T |
17056961 |
gttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacgccccacttatt |
17056897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 39434612 - 39434696
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| | ||||| || | ||| ||||||||| | ||||||||||||||| |
|
|
| T |
39434612 |
tgtcccatgagcatagttcagttggtatgacaatgcattgttatatgtaggagccgatgttcgaacctcggacaccccacttatt |
39434696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 122
Target Start/End: Complemental strand, 40814866 - 40814790
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc |
122 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||||||||| |||||||| ||||| |||||||| | | |||||||| |
|
|
| T |
40814866 |
gtcccgtgagcatagctcagttagtaagacaatgcattattatatgcaggggtcggggttcgaaacccggacacccc |
40814790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 2208718 - 2208655
Alignment:
| Q |
66 |
ttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||| |||||||| || |||||||| |||| |||||| |||||||||| |
|
|
| T |
2208718 |
ttggtaggacaatgcattattatatgcaggggacgaggttcaaaccccagacatcccacttatt |
2208655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 40 - 129
Target Start/End: Original strand, 38021239 - 38021330
Alignment:
| Q |
40 |
gtcattgtccc-gtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||| |||||||| | |||||||||||||| |||||||| || || ||||||||| | ||||||||||||||| |
|
|
| T |
38021239 |
gtcattgtccccgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttatt |
38021330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 109
Target Start/End: Original strand, 49916435 - 49916498
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
49916435 |
gtcccgtgagcatagatcaattggtaggacaatgcattattatatgtaggggtcggggttcgaa |
49916498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 17350057 - 17350139
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| |||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
17350057 |
cccgtgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
17350139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 19793526 - 19793604
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||| || || |||||||| | ||||||||||||||| |
|
|
| T |
19793526 |
gtgagcataactcagttggtaggacaatgcattattatatgcaggggccggaattcgaaccccggacaccccacttatt |
19793604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 40 - 94
Target Start/End: Complemental strand, 29331270 - 29331216
Alignment:
| Q |
40 |
gtcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||| |||||||||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
29331270 |
gtcagtgtcccgtgagcatagcttagttggtaggacaatgcattattatatgcag |
29331216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 34560440 - 34560355
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| |||||||||| ||||| | |||| ||||||||||| | ||||||||||||||| |
|
|
| T |
34560440 |
attgtcccgtgagtttagctcagttggtaggataatgcattattatatgtatgggtc-aggttcgaacctcggacaccccacttatt |
34560355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 40678819 - 40678901
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || ||||||| || | ||||||||||||||| |
|
|
| T |
40678819 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttatt |
40678901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 43837500 - 43837418
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| | ||||||| ||||| |||||||||| ||||||||| ||||| |
|
|
| T |
43837500 |
tcccgtgagcatagctcagttggtaggaaaatgcattcttctatgcaggggtcggggttcgaaccctggacaccccatttatt |
43837418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 48110525 - 48110607
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||||||| |||||||| ||| | ||||||||| | |||||| |||||||| |
|
|
| T |
48110525 |
tcccgtgagcgtagctcagttggtagaacaatgcattattatatgcaggggttggagttcgaacctcggacacctcacttatt |
48110607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 9768907 - 9768826
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||| | |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
9768907 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt |
9768826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 20357455 - 20357520
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| || | |||||||||| |
|
|
| T |
20357455 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggctggggttcgaacc |
20357520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 20562500 - 20562435
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| || | |||||||||| |
|
|
| T |
20562500 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggctggggttcgaacc |
20562435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 129
Target Start/End: Complemental strand, 16110109 - 16110037
Alignment:
| Q |
57 |
atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||| |||||||||||||||| |||||||| ||| |||||||||||| || | || ||||||||| |
|
|
| T |
16110109 |
atagctcagttgataggacaatgcattattatatgcaggggttgaggttcgaaccccaaagactccacttatt |
16110037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 24168676 - 24168596
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||| |||||| ||||||||| ||||| || | || |||||||||| ||||||||||||||||| |
|
|
| T |
24168676 |
ccgtgagcatagctcagtttgtaggaacatgcattattatatgtagggaccggggttcgaaccccagacaccccacttatt |
24168596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 93
Target Start/End: Complemental strand, 49010805 - 49010753
Alignment:
| Q |
41 |
tcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| ||||| ||||||| |
|
|
| T |
49010805 |
tcatcgtcccgtgagcatagctcagttggtaggacaatgtattattatatgca |
49010753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 17064351 - 17064284
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| | |||||||||||| ||||| ||| || |||||||||||| | ||||||||||||||| |
|
|
| T |
17064351 |
tcagttggttgtacaatgcattattatatgtagaagttgaggttcgaaccactgacaccccacttatt |
17064284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 91
Target Start/End: Complemental strand, 29442065 - 29442022
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatg |
91 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
29442065 |
cccgtgagcatagctcagttggtaggacaatgcattattatatg |
29442022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 32711223 - 32711161
Alignment:
| Q |
66 |
ttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||||||||||| |||||||| || || |||||||||| ||||||||||||||||| |
|
|
| T |
32711223 |
ttggtagaacaatgcattattatatgcag-ggccggggttcgaaccccagacaccccacttatt |
32711161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 43237784 - 43237851
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| |||| ||||||||| ||||||||||| ||||| |
|
|
| T |
43237784 |
tcagctggtaggacaatgcattattatatgcaggggtcagagttcgaaccacagacaccccagttatt |
43237851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 47763485 - 47763402
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||||||| |||||||| || || ||||||||| | |||| |||||||||| |
|
|
| T |
47763485 |
tcccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccacttatt |
47763402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 49606798 - 49606715
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||||||| ||||||| |||||||||||||||| ||||| || || || |||||||| | ||||||||||||||| |
|
|
| T |
49606798 |
gtcccgtaagcatagctcagttgttaggacaatgcattattatatgtaggggccggagttcgaacttcggacaccccacttatt |
49606715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9527422 - 9527504
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||| | |||||||| ||||| |||| ||||| ||||||||||||||| |
|
|
| T |
9527422 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttatt |
9527504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 35111646 - 35111727
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
35111646 |
cccgtgagcatagctcagttgataggaacaatgcattattatatgcag-gggcggggttcgaacccctaacaccccacttatt |
35111727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 11405477 - 11405534
Alignment:
| Q |
72 |
ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| | |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
11405477 |
ggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt |
11405534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 126
Target Start/End: Original strand, 38851633 - 38851710
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| ||||| || |||| ||||| || | |||||||| ||||| |
|
|
| T |
38851633 |
ccgtgagaatagctcagttggtaggacaatgcattattatatgtaggtgtcggggttcaaatcccagacacctcactt |
38851710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 749683 - 749604
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||| ||||| || ||| | |||||||||| | ||||||||||||||| |
|
|
| T |
749683 |
ccgtgagcataactcagttggtcgaacaatgcattattatatgtaggggttggggttcgaacc-ccgacaccccacttatt |
749604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 129
Target Start/End: Original strand, 21635563 - 21635635
Alignment:
| Q |
57 |
atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||| |||||| |||||||||||| ||||||||| |||| ||||| |||| ||||||||||| ||||| |
|
|
| T |
21635563 |
atagctcaattggtaagacaatgcattaatatatgcagatgtcggggttcaaaccccagacaccccagttatt |
21635635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 22346412 - 22346479
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||| |||||| ||| |||| ||||| |||||||||| |
|
|
| T |
22346412 |
attgtgccgtgagcatagctaagttggtaggacaatacattattataagcaggggtcg-ggttcgaacc |
22346479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 11213549 - 11213466
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||| ||||| |||||||||| ||||| |||||| ||||| |||||| | ||||||||| | ||||||||||||||| |
|
|
| T |
11213549 |
gtcctgtgaacatagctcagttggtaaaacaatacattattatatgtagaggttggagttcgaaccccggacaccccacttatt |
11213466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 124
Target Start/End: Complemental strand, 11907403 - 11907324
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccac |
124 |
Q |
| |
|
||||||||||||||| | | || || |||||||||||||| ||||||||||| || |||||||||| | ||||||||| |
|
|
| T |
11907403 |
tgtcccgtgagcataacttaattagttggacaatgcattattatatgcagaggccggggttcgaaccccgaacaccccac |
11907324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 13870177 - 13870098
Alignment:
| Q |
51 |
gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| |||||||| || || |||| ||| | | ||||||||||||||| |
|
|
| T |
13870177 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccacttatt |
13870098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 1721140 - 1721218
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| | |||||||| || || | |||||||| | |||||| |||||||| |
|
|
| T |
1721140 |
gtgagcatagctcagttggtaggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacctcacttatt |
1721218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 2643913 - 2643832
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| | |||||| || |||| |||||||| ||||||| ||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
2643913 |
cccgtgagcatagcttagttggcagagaca-tgcattattatatgcatgggtcggggtttgaaccccagacaccccacttatt |
2643832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 9410425 - 9410345
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| | ||||| ||||| | |||||||| ||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
9410425 |
cccgtgagcatagttcagttggcaaggaca-tgcatagttatatgcag-ggttgagattcgaacctcagacaccccacttatt |
9410345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 25819181 - 25819263
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| ||||| || | || |||||||||| | || |||||||||||| |
|
|
| T |
25819181 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccacttatt |
25819263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 95
Target Start/End: Complemental strand, 33059597 - 33059543
Alignment:
| Q |
41 |
tcattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcaga |
95 |
Q |
| |
|
|||| |||| |||| ||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
33059597 |
tcatagtcctgtgaacatagctcagttggtaggataatgcattattatatgcaga |
33059543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 5680707 - 5680772
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||| || ||| ||||||||||| || |||||||||| ||||| || ||||| |||||||||| |
|
|
| T |
5680707 |
gtcccgtaagtataattcagttggtaagataatgcattattatatgtaggggtcggggttcgaacc |
5680772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7906424 - 7906343
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | |||||||| || | |||||||||| |||||||| |||||| |
|
|
| T |
7906424 |
cccgtgagcatagttcagttggtagggacatgcattgttatatgcaggggctggggttcgaacccgggacaccccgcttatt |
7906343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 11802104 - 11802055
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || ||| | |||||||||| |
|
|
| T |
11802104 |
tcagttggtaggacaatgcattattatatgtaggggttggggttcgaacc |
11802055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 41 - 90
Target Start/End: Complemental strand, 12073182 - 12073133
Alignment:
| Q |
41 |
tcattgtcccgtgagcatagttcagttggtaggacaatgcattataatat |
90 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
12073182 |
tcatggtcccgtgagcataactcagttggtaggataatgcattattatat |
12073133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 12553191 - 12553272
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc-gaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| || ||||||||||||| ||||||| | |||||||| || | | |||||||||| | ||||||||||||||| |
|
|
| T |
12553191 |
ccgtgagcacagctcagttggtaggaacatgcattgttatatgcaggggccgggggttcgaaccccggacaccccacttatt |
12553272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 12866117 - 12866202
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcaga-ggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||| || ||||||||| |||||||||| ||||||||| || || |||||||| | || |||||| ||||||| |
|
|
| T |
12866117 |
tgtcctgtgagcatagctcgattggtaggataatgcattattatatgcagagggccggggttcgaatcccacacaccctacttatt |
12866202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 77 - 126
Target Start/End: Original strand, 42801905 - 42801954
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||||| | |||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
42801905 |
atgcattgttatatgcagaggttggggttcgaaccccagacaccccactt |
42801954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 2903096 - 2903044
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| | |||||||||||||| |||||||||| | |||||||||||||| |
|
|
| T |
2903096 |
atgcattgttatatgcagaggtcggggttcgaaccccgaacaccccacttatt |
2903044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 129
Target Start/End: Original strand, 4616903 - 4616951
Alignment:
| Q |
81 |
attataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||| || ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
4616903 |
attattatatgtaggggtcgcggttcgaaccacagacaccccacttatt |
4616951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 11238097 - 11238045
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||| | | ||||||||||||||| |
|
|
| T |
11238097 |
atgcattattatatgcaggggtcggggttcgaatcccggacaccccacttatt |
11238045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 85
Target Start/End: Original strand, 23990329 - 23990365
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattat |
85 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
23990329 |
ccgtgagcatagctcagttggtaagacaatgcattat |
23990365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 94
Target Start/End: Complemental strand, 24014704 - 24014660
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||| |||| |||||||||| ||||||||||||| |||||||| |
|
|
| T |
24014704 |
cgtgagtatagctcagttggtaagacaatgcattattatatgcag |
24014660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 52833207 - 52833123
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| || |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||| |||| ||||| |
|
|
| T |
52833207 |
gtcccgtgagcctaactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttatt |
52833123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 66; Significance: 2e-29; HSPs: 78)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 30474297 - 30474212
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
30474297 |
ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttatt |
30474212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 3179316 - 3179402
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
3179316 |
attgtcccgtgagcataactcagttggtagaacaatgcattattatatgcaggggtcgaggttcgaacctcagacaccccacttatt |
3179402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 10262734 - 10262817
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
10262734 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttatt |
10262817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 580884 - 580800
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
580884 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
580800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 36520882 - 36520797
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| ||||| || ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
36520882 |
ttgtcccgtgagcgtagctcagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttatt |
36520797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 8234894 - 8234809
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||| ||||| || || || |||||||||| | ||||||||||||||| |
|
|
| T |
8234894 |
ttgtcccgtgagcatagctcagttggtaggacaatacattattatatgtaggggccggggttcgaaccccggacaccccacttatt |
8234809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 44187701 - 44187782
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
44187701 |
ccgtgagcatagttcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttatt |
44187782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 17154643 - 17154727
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
17154643 |
tgtcccgtgagcataactcggttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
17154727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 17239896 - 17239979
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||||||| ||||||||||| |||||||||||| |||||||| ||||| | |||||||| | ||||||||||||||| |
|
|
| T |
17239896 |
gtcccatgagcatagctcagttggtagaacaatgcattattatatgcaggggtcgggattcgaacctcggacaccccacttatt |
17239979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 11133072 - 11133154
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| | |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
11133072 |
cccgtgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt |
11133154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 20122574 - 20122492
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| || || || |||||||||| | ||||| ||||||||| |
|
|
| T |
20122574 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacacgccacttatt |
20122492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 2114536 - 2114452
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| ||||| || ||||| |||||||||| | |||||| || ||||| |
|
|
| T |
2114536 |
tgtcccgtgagcatagctcagttggtagaacaatgcattattatatgtaggggtcggggttcgaaccccggacacctcatttatt |
2114452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 36665428 - 36665508
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
36665428 |
ccgtgagtatagctcagtttgtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt |
36665508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 15392311 - 15392228
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| || | ||||||||||||| | |||||| |||||||| |
|
|
| T |
15392311 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggagacgaggttcgaacctcggacacctcacttatt |
15392228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 16028192 - 16028125
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| ||||||||| |||||| |||||||||| |
|
|
| T |
16028192 |
tcagttggtaggacaatgcattattatatgcagtggtcggggttcgaactccagacatcccacttatt |
16028125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 22297548 - 22297469
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| || | |||||||||| | ||||||||| ||||| |
|
|
| T |
22297548 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggcaggggttcgaaccccggacaccccatttatt |
22297469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 129
Target Start/End: Complemental strand, 24034145 - 24034070
Alignment:
| Q |
54 |
agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| | |||||||||||||||||||||| |||||||| ||||| |||||||||| | ||||| ||||||||| |
|
|
| T |
24034145 |
agcatagcttagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcggacactccacttatt |
24034070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 20533753 - 20533835
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||| |||||| |||||||||| |||||||||||||| || ||| |||||||||| |
|
|
| T |
20533753 |
tcccatgagcatagctcagttggtagaacaaaacattattatatgcagagatcgaggttcgaaccccacacatcccacttatt |
20533835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 46 - 128
Target Start/End: Complemental strand, 25050340 - 25050258
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
|||| |||||||||| ||||||||||||| |||||||||| |||||||| ||||| | |||||||| ||||||| | |||||| |
|
|
| T |
25050340 |
gtccagtgagcatagctcagttggtaggataatgcattattatatgcaggggtcgggattcgaaccccagacacacaacttat |
25050258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 127
Target Start/End: Complemental strand, 26807181 - 26807103
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta |
127 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| || | |||||||||| ||| ||||||||||| |
|
|
| T |
26807181 |
ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccagggttcgaaccccaggcaccccactta |
26807103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 39726535 - 39726469
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
39726535 |
tgtcccgtgagtctagctcagttggtaggacaatgcattattatatgtaggggtcgaggttcgaacc |
39726469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 56 - 129
Target Start/End: Original strand, 20208866 - 20208938
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||| ||||||||||||| |||| ||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
20208866 |
catagctcagttggtaagacaatgcattattatatacagaggttgaggttcgaaccccagac-ccccacttatt |
20208938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 27495533 - 27495598
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||| |||||||| ||| ||| |||||||| |
|
|
| T |
27495533 |
gtcccgtaagcataattcagttggtaggacaatgcattattatatgcaggggttgagattcgaacc |
27495598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 56 - 129
Target Start/End: Original strand, 32891286 - 32891359
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| ||||| |||||||| | ||||||||||||||| |
|
|
| T |
32891286 |
catagctcagttggtaggacaatgcattattatatgcaggggtcggttttcgaaccccggacaccccacttatt |
32891359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 130
Target Start/End: Original strand, 9802892 - 9802971
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta |
130 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||| ||||||| ||||| |||||||||| | |||||||||||||||| |
|
|
| T |
9802892 |
cgtgagcatagctcagttgat-ggacaatgcattattatatgcaagggtcggggttcgaaccccggacaccccacttatta |
9802971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 57 - 129
Target Start/End: Complemental strand, 44721793 - 44721721
Alignment:
| Q |
57 |
atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||||| |||||||||||| |||||||| ||||| |||||||||| | ||||||||| ||||| |
|
|
| T |
44721793 |
atagctcagttggtagaacaatgcattattatatgcaggggtcggggttcgaacctcggacaccccatttatt |
44721721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 1836583 - 1836666
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| ||||| || ||| |||||||||| | ||||||| ||||||| |
|
|
| T |
1836583 |
gtcccgtgagcctagctcagttggtaggacaatgcattattatatgaaggaatcggggttcgaaccccggacaccctacttatt |
1836666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 7086248 - 7086331
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| |||||||| || || | |||||||| | |||||||| ||||| |
|
|
| T |
7086248 |
gtcccgtgagcatagctcagttggtagggcaatgcattattatatgcaggggccgggattcgaaccccgaacaccccaattatt |
7086331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 109
Target Start/End: Complemental strand, 9791991 - 9791932
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| || |||| |||||||| |
|
|
| T |
9791991 |
cgtgagcatagttcagttggtaggacaatgcattattatatgtaggtgtcggggttcgaa |
9791932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 9796897 - 9796975
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||| ||||||| | |||||||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
9796897 |
cgtgaccatagctcagttgat-ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
9796975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 16973903 - 16973986
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| ||||| |||||||| ||| | |||||||| | ||||||||||||||| |
|
|
| T |
16973903 |
gtcccgtgagcatagctcagtttgtaggacaatggattattatatgcaggggttaggattcgaaccccggacaccccacttatt |
16973986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 41699101 - 41699180
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| |||||||| ||||| |||||||||| | |||||||||||||| |
|
|
| T |
41699101 |
cgtgagcataactcagttggtaggatattgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttatt |
41699180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 17115643 - 17115561
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||| ||||||| |||||| ||||||||| | |||| |||| ||||| |
|
|
| T |
17115643 |
tcccgtgagcatagctcagttggtaggacactgtattattatatgcaaaggtcggagttcgaaccccggacatcccatttatt |
17115561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 18007249 - 18007327
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| ||||| | |||| | ||||| |||| || |||||||||||||| |
|
|
| T |
18007249 |
gtgaacatagttcagttggtaggacaatgtattattatatgtaaaggttggggttcaaaccccatacaccccacttatt |
18007327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 19052706 - 19052628
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| |||||||| |||| | |||||||| | |||| |||||||||| |
|
|
| T |
19052706 |
gtgaacatagttcaattggtaggacaatgcattattatatgcaggggtcaggattcgaaccccggacatcccacttatt |
19052628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29034972 - 29035054
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| |||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
29034972 |
cccgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
29035054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 129
Target Start/End: Original strand, 3364738 - 3364803
Alignment:
| Q |
64 |
agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||| |||||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
3364738 |
agttggtaggacaatacattattatatgcaggggccgaggttcgaactttagacaccccacttatt |
3364803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 9547229 - 9547144
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||| ||||| |||||||| || || |||||||| | | |||||||||||||| |
|
|
| T |
9547229 |
ttgtcccgtgaacatagctcagttgataggacaatgtattattatatgcaggggccggggttcgaatcccgaacaccccacttatt |
9547144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 100
Target Start/End: Original strand, 10207638 - 10207694
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcg |
100 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
10207638 |
ttgttccgtgagcatagctcagttggtaggataatgcattattatatgcagtggtcg |
10207694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 14307791 - 14307711
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| | |||||||||||| ||||||| | |||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
14307791 |
ccgtgagcatggctcagttggtagggacatgcattgttatatgcaggggtcgaggttcgaaccccgaacaccccacttatt |
14307711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 15690134 - 15690086
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| | |||||||| |
|
|
| T |
15690134 |
gtcccgtgagcatagctcagttggtaggacaatgcattgttatatgcag |
15690086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 31564090 - 31564138
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
31564090 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcag |
31564138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 129
Target Start/End: Original strand, 32943345 - 32943417
Alignment:
| Q |
57 |
atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
32943345 |
atagctcagttggtaggacaatgcattattatatgcagaggctggggttcgaatttcggacaccccacttatt |
32943417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 33001654 - 33001570
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| ||||||| || || |||| ||| | | ||||||||||||||| |
|
|
| T |
33001654 |
tgtcccgtgagcataactcagttggtaggacaatgcgttattatatgcaagggccggggtttgaatcccggacaccccacttatt |
33001570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 93
Target Start/End: Original strand, 36481067 - 36481111
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
36481067 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgca |
36481111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 44422105 - 44422185
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| | | | |||||||||||||||||||| |||||||| | ||| ||||||||| | ||||||||||||||| |
|
|
| T |
44422105 |
ccgtgagcatggcttatttggtaggacaatgcattattatatgcagggatcggagttcgaaccccggacaccccacttatt |
44422185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 106
Target Start/End: Complemental strand, 18364474 - 18364415
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttc |
106 |
Q |
| |
|
|||||||||||||| | ||||||||| |||||||||||| |||||||| ||||| ||||| |
|
|
| T |
18364474 |
tcccgtgagcatagctgagttggtagaacaatgcattattatatgcaggggtcggggttc |
18364415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 109
Target Start/End: Original strand, 22538534 - 22538597
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |||||||| ||| | |||||||| |
|
|
| T |
22538534 |
gtcccgtgagcctaactcagttggtaggacaatgcattattatatgcaggggttggggttcgaa |
22538597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 32527177 - 32527094
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| | ||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| |||||| |||||||||| |
|
|
| T |
32527177 |
tcccgtaaacatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccacttatt |
32527094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 38530294 - 38530211
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagagg-tcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||||||| |||| ||| || | | ||||||||| || ||||||||||||||| |
|
|
| T |
38530294 |
tcccgtaagcttagctcagttggtaggacaatgcattattatatacaggggcttggggttcgaactgcggacaccccacttatt |
38530211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 2304286 - 2304368
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||| |||||||| ||| |||||| ||||| ||||| || ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
2304286 |
cccgtgagcttagctcagttggcagggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccacttatt |
2304368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 2558359 - 2558293
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||| ||||| || |||| |||||||||| |
|
|
| T |
2558359 |
tgtcccgtgagaatagctcaattggtaggacaatgcattattatatgtaggggtcagggttcgaacc |
2558293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 91
Target Start/End: Original strand, 14879122 - 14879168
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatg |
91 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
14879122 |
tgtcccgtgagcatagttccgttggtaggacaatacattattatatg |
14879168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 32988346 - 32988428
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| ||| |||| || | ||||||||| | |||||||||||||| |
|
|
| T |
32988346 |
tcccgtgagcatagctcagttggtaagacaatgcattattatacgcaggggctggggttcgaacatcgaacaccccacttatt |
32988428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 36426951 - 36426873
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| ||||| || ||| | ||||||||| | |||||||||||||| |
|
|
| T |
36426951 |
gtgagcatagctcacttggtaggacaatgcattattatatgtaggggttggggttcgaactccgaacaccccacttatt |
36426873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 126
Target Start/End: Original strand, 16261326 - 16261407
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||| |||||||||| ||| ||||||| | |||||||| | |||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
16261326 |
tgtcctgtgagcatagctcaattggtagtataatgcattgttatatgcaggggtcagagttcgaaccccagacaccccactt |
16261407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 27875061 - 27875109
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
27875061 |
tgtcccgtgagcatagttcagttggta-gacaatccattatcatatgcag |
27875109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 34107271 - 34107352
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||| || || |||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
34107271 |
cccgtgagcatagctcagttggcagggacatgtataattatatgcaggggttgaggttcgaactccagacaccccacttatt |
34107352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 119
Target Start/End: Original strand, 34620517 - 34620586
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacac |
119 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| ||||||| ||| | |||| ||||| ||||||| |
|
|
| T |
34620517 |
cgtgagcatagctcggttggtaggacaatgcattattatatgcaagggttggggtttgaaccccagacac |
34620586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 129
Target Start/End: Original strand, 25731956 - 25732012
Alignment:
| Q |
73 |
gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
25731956 |
gacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttatt |
25732012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 129
Target Start/End: Complemental strand, 19905735 - 19905672
Alignment:
| Q |
66 |
ttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||||| |||| ||| ||||| |||||||||| | ||||||| ||||||| |
|
|
| T |
19905735 |
ttggttggacaatgcattattatatacaggggtcggggttcgaaccccggacacccgacttatt |
19905672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 124
Target Start/End: Complemental strand, 41711733 - 41711658
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccac |
124 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| ||||| || |||| ||| ||||| | |||||||||| |
|
|
| T |
41711733 |
ccgtgagcatagctctgttggtaggacaatgcattattatatgtaggagtcggtgtttgaaccccggacaccccac |
41711658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 45523676 - 45523743
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||| |||||||||| || ||||| ||| |||| |
|
|
| T |
45523676 |
tcagttggtaggacaatgtataattatatgcaggggtcggggttcgaaccccaaacacctcacctatt |
45523743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 5029195 - 5029117
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| ||||||||||| || ||||||| | | |||||||||||||| |
|
|
| T |
5029195 |
gtgagcatagctcagttggtaggtatatgcattattatatgcagaggccggagttcgaatctcgaacaccccacttatt |
5029117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 126
Target Start/End: Complemental strand, 21875069 - 21874991
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||| || |||||||| || ||||||||| || | |||||||||||| |
|
|
| T |
21875069 |
cccgtgagcataattcagttggtgggaacatgcataattatatgcaggggcagaggttcgatccccggacaccccactt |
21874991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 21970538 - 21970456
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||||| |||||||| | ||| |||||||||| | || ||||| |||||| |
|
|
| T |
21970538 |
cccgtgagcatagctcagttgacagggacaatgcattattatatgcagggatcggggttcgaaccccggataccccgcttatt |
21970456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 23405196 - 23405277
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||| |||||||||||| ||| ||||| ||| ||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
23405196 |
cccgtgagcttagctcagttggtagggacattgcataata-tatgcaggggtcggggttcgaaccctggacaccccacttatt |
23405277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29664599 - 29664681
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| |||| ||| |||||||||| | |||||||| ||||| ||||| || | | ||||||||||||||| |
|
|
| T |
29664599 |
cccgtgagcatagctcaattggcagggacaatgcattgttatatgcaggggtcggggttcaaatcccggacaccccacttatt |
29664681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 34034347 - 34034428
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||| |||||| |||||||| | || |||||||||| | ||||||||||||||| |
|
|
| T |
34034347 |
cccgtgagcatagctcagttggcagggacaatacattattatatgcag-gaccggggttcgaaccccggacaccccacttatt |
34034428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 120
Target Start/End: Complemental strand, 35049249 - 35049176
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacc |
120 |
Q |
| |
|
||||| |||||||| ||||||||||| |||||||||||| |||| || |||||| |||||||||| | |||||| |
|
|
| T |
35049249 |
gtcccatgagcataactcagttggtagaacaatgcattattatataca-aggtcggggttcgaacctcggacacc |
35049176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 3037696 - 3037639
Alignment:
| Q |
72 |
ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| | |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
3037696 |
ggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttatt |
3037639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 18386902 - 18386829
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||| |||||||||||||||||||| ||||| || || | ||||||||| | ||||||||||||||| |
|
|
| T |
18386902 |
catagctcaattggtaggacaatgcattattatatgtaggggctggggttcgaactccggacaccccacttatt |
18386829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 96 - 129
Target Start/End: Original strand, 36190099 - 36190132
Alignment:
| Q |
96 |
ggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
36190099 |
ggtcgaggttcgaacctcagacaccccacttatt |
36190132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 119
Target Start/End: Complemental strand, 17974883 - 17974839
Alignment:
| Q |
75 |
caatgcattataatatgcagaggtcgaggttcgaaccgcagacac |
119 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
17974883 |
caatgcattgttatatgcagaggccgaggttcgaaccccagacac |
17974839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 33956251 - 33956295
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatat |
90 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |||| |
|
|
| T |
33956251 |
gtcccgtgagcataactcaattggtaggacaatgcattattatat |
33956295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 38402792 - 38402836
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatat |
90 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
38402792 |
gtcccgtgagcataactcggttggtaggacaatgcattattatat |
38402836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 38820573 - 38820652
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||| ||||| || || | |||| ||||| ||||||||||| ||||| |
|
|
| T |
38820573 |
ccgtgaacatagctcagttgttaggacaatgcattattatatgtaggggctggggtttgaacc-cagacaccccatttatt |
38820652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Original strand, 45314436 - 45314488
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
45314436 |
atgcattgttatatgcagaggtcggggttcgaacttcagacatcccacttatt |
45314488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 86)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 43566898 - 43566813
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
43566898 |
ttgtcccgtgaacatagctcagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcagacaccccacttatt |
43566813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 33206750 - 33206835
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| || | |||||||||| | ||||||||||||||| |
|
|
| T |
33206750 |
ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttatt |
33206835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 35483262 - 35483347
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |||||||| ||||| |||||||| | | ||||||||||||||| |
|
|
| T |
35483262 |
ttgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttatt |
35483347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 44 - 128
Target Start/End: Complemental strand, 24751362 - 24751278
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
24751362 |
ttgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
24751278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 16006606 - 16006523
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
16006606 |
gtcccgtgagcataactcagttggtagaacaatgcattataatatgcaagagtcggggttcgaaccccagacaccccacttatt |
16006523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 40786279 - 40786358
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| ||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
40786279 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcatgggtcggggttcgaacctcagacgccccacttatt |
40786358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 49146080 - 49146162
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
49146080 |
tcccgtgagcttaactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
49146162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 50 - 126
Target Start/End: Original strand, 41121870 - 41121946
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||| ||||| |||| | |||||||||||| |
|
|
| T |
41121870 |
cgtgagcataactcagttggtaggacaatgcattattatatgcagaggtcggggttcaaaccccggacaccccactt |
41121946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 50724362 - 50724445
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||| |||||||| ||| | |||||||||| | ||||||||||||||| |
|
|
| T |
50724362 |
tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttatt |
50724445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 50788486 - 50788403
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||| |||||||| ||| | |||||||||| | ||||||||||||||| |
|
|
| T |
50788486 |
tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttatt |
50788403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 8475414 - 8475493
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||| |||| ||| | |||||| || ||||||| |
|
|
| T |
8475414 |
cgtgagcatagctcagttggtaggacaatgcattatgatatgcagaggtcggggtttgaatcccagacatccaacttatt |
8475493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21420289 - 21420206
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| |||||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
21420289 |
gtcccgtgagtttagctcagttggtaggacaatgcattattatatgcagcggtcgaggttcgaatcctggacaccccacttatt |
21420206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 49639023 - 49639106
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| || || || |||||||||| | |||||||||||||| |
|
|
| T |
49639023 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccgaacaccccacttatt |
49639106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 54 - 129
Target Start/End: Original strand, 53467952 - 53468026
Alignment:
| Q |
54 |
agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
53467952 |
agcatagttcagttggtaggacaatgcattattatatgcag-gggcggggttcgaacctcggacaccccacttatt |
53468026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 13540063 - 13539981
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| ||||| || ||| | |||||||||| | ||||||||||||||| |
|
|
| T |
13540063 |
tcccgtgagtatagctcagttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacaccccacttatt |
13539981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 46 - 108
Target Start/End: Original strand, 50720417 - 50720479
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
50720417 |
gtcccgtgagcatagttcagttggtaggacaatgcattattatatgtatgggtcgaggttcga |
50720479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 46 - 108
Target Start/End: Complemental strand, 50792431 - 50792369
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
50792431 |
gtcccgtgagcatagttcagttggtaggacaatgcattattatatgtatgggtcgaggttcga |
50792369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 36727552 - 36727480
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |||||| |||||||||| | ||||||||||||||| |
|
|
| T |
36727552 |
catagctcagttggtaggacaatgcattattatatgca-aggtcggggttcgaacctcggacaccccacttatt |
36727480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 42271115 - 42271030
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| | |||||||| || || ||||||||| | ||||||| ||||||| |
|
|
| T |
42271115 |
ttgtcccgtgagcatagctcagttggtaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccctacttatt |
42271030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 16278051 - 16277968
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |||||||| ||||| | ||||||| | |||| |||||||||| |
|
|
| T |
16278051 |
gtcccgtgagcatagctcagttggtaggaccatgcattattatatgcaggggtcgggattcgaactccggacatcccacttatt |
16277968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 23820640 - 23820707
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || || ||||||||| ||||||||||||||||| |
|
|
| T |
23820640 |
tcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccagacaccccacttatt |
23820707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9624979 - 9625061
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
9624979 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
9625061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 27183780 - 27183698
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
27183780 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
27183698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 38555126 - 38555045
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||| |||||||| ||||| |||||||||| || ||||| |||||||| |
|
|
| T |
38555126 |
cccgtgagcatagttcagttggcagagacaatgcattattatatgcaggggtcg-ggttcgaacctcaaacacctcacttatt |
38555045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 43774181 - 43774263
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| |||| |||||||| ||| |||||||||| | |||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
43774181 |
cccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttatt |
43774263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 49019187 - 49019261
Alignment:
| Q |
55 |
gcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| || ||||| |||||||| | |||||||| |||||||| |
|
|
| T |
49019187 |
gcatagttcagttggtaagacaatgcattattatatgtaggggtcggggttcgaatctcagacaccgcacttatt |
49019261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 19137616 - 19137697
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||| | |||||||| || ||||||||||||| ||||||||||| ||||| |
|
|
| T |
19137616 |
cccgtgagcatagctcagttggcaggaacatgcattgttatatgcaggggccgaggttcgaaccccagacaccccatttatt |
19137697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 32508896 - 32508811
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| || ||||||| ||||| |||||||||| |||||||| ||||| |||||||||| | |||||||||||||| |
|
|
| T |
32508896 |
ttgtcccgtgagcctaactcagttgataggataatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttatt |
32508811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 36331824 - 36331743
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||| |||| ||| |||||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
36331824 |
ccgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
36331743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 13616175 - 13616091
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||| ||||| || ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
13616175 |
tgtcccgtgaacataactcggttggtaggacaatgcattattatatgtaggggtcggagttcgaacctcggacaccccacttatt |
13616091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 54983811 - 54983722
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattat----aatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| |||||||| ||||| |||||||||| | ||||||||| ||||| |
|
|
| T |
54983811 |
ttgtcccgtgagcatagctcagttggtaggataatgcattattatatatatgcaggggtcggggttcgaaccccggacaccccatttatt |
54983722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 14417863 - 14417946
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||||||||||| |||||||| || | ||||||||| | ||||||||||||||| |
|
|
| T |
14417863 |
gtcccatgagcatagctcaattggtaggacaatgcattattatatgcaggggctggagttcgaaccccggacaccccacttatt |
14417946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 17440065 - 17439982
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |||||||| || || ||| ||||| | || |||||||||||| |
|
|
| T |
17440065 |
gtcccgtgagcatagctcggttggtaggacaatgcattattatatgcaggggccggtgtttgaacctcggataccccacttatt |
17439982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 38176053 - 38176132
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| ||| |||||| | || || |||||||||| |||||| |||||||||| |
|
|
| T |
38176053 |
cgtgaacatagctcagttggtaggacaatgcaatattatatgctggggccggggttcgaaccccagacagcccacttatt |
38176132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7448462 - 7448380
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||| |||||||| || || | |||||||| |||| |||||||||||| |
|
|
| T |
7448462 |
cccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttatt |
7448380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7456604 - 7456522
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||| |||||||| || || | |||||||| |||| |||||||||||| |
|
|
| T |
7456604 |
cccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttatt |
7456522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 14868681 - 14868763
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
14868681 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatt |
14868763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Original strand, 34503209 - 34503258
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
34503209 |
tgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcag |
34503258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 125
Target Start/End: Complemental strand, 35849369 - 35849300
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccact |
125 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| | | |||||||||| ||||||||||||| |
|
|
| T |
35849369 |
catagctcagttggtaggacaatgcattattatatgcagggactgtggttcgaacctcagacaccccact |
35849300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 32876211 - 32876151
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||| |||||| |||| |||| |
|
|
| T |
32876211 |
gtgagcatatctcagttggtaggacaatgcattattatatgcaggggtcgaagttcaaacc |
32876151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 45713474 - 45713558
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| ||||| || || || |||||||| | ||||||||||||||| |
|
|
| T |
45713474 |
tgtcccgtgagcataacttagttggtaggacaatgcattattatatgtaggggccggagttcgaactccggacaccccacttatt |
45713558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 129
Target Start/End: Original strand, 53472615 - 53472703
Alignment:
| Q |
42 |
cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagagg-tcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||||||| | | |||||||||||||||||||| ||||| ||||| ||| |||| |||| || |||||||||||||| |
|
|
| T |
53472615 |
cattgtcccatgagcatagcttaattggtaggacaatgcattattatatggagaggatcggggtttgaactccaaacaccccacttatt |
53472703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 13874933 - 13874851
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||| ||||||||| |||||||||||||| |||||||| ||||| ||||| || | |||||| |||| ||||| |
|
|
| T |
13874933 |
gtcccgtgaacatagctcagttggt-ggacaatgcattattatatgcaggggtcggggttcaaatcccagacatcccatttatt |
13874851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 123
Target Start/End: Complemental strand, 16874288 - 16874213
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccca |
123 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||| | |||||||| || ||||||||||||||| ||||||||| |
|
|
| T |
16874288 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccgcggacacccca |
16874213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 27066605 - 27066688
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||||||| |||||||||| || || |||||| |||||||| |||| |||||||||| | ||||||||||||||| |
|
|
| T |
27066605 |
gtcccgtaagcatagctcagttggtaagataaatcattattatatgcaggggtcagggttcgaaccccggacaccccacttatt |
27066688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 110
Target Start/End: Original strand, 34136755 - 34136822
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||| ||||| || ||| | ||||||||| |
|
|
| T |
34136755 |
attgtcctgtgagcatagctcagttggtagaacaatgcattattatatgtaggggttggggttcgaac |
34136822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 124
Target Start/End: Original strand, 3784069 - 3784143
Alignment:
| Q |
51 |
gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccac |
124 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| |||| ||| ||||| |||||||||| | |||||||||| |
|
|
| T |
3784069 |
gtgagcatagctcagttggcagggacaatgcattattatatacaggggtcggggttcgaaccccggacaccccac |
3784143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 10959129 - 10959211
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||| || || || |||||||||| | ||||||||||||||| |
|
|
| T |
10959129 |
cccgtgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttatt |
10959211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 19540334 - 19540384
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
19540334 |
ttgtcccatgagcatagctcagttggtaggacaatacattattatatgcag |
19540384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 111
Target Start/End: Original strand, 20244140 - 20244194
Alignment:
| Q |
57 |
atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||| || || |||||||||| |
|
|
| T |
20244140 |
atagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacc |
20244194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 24559385 - 24559467
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||| | ||| | ||||||| || |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
24559385 |
cccgtgagcatagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
24559467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 148
Target Start/End: Original strand, 29507215 - 29507316
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt--agccactaggctacctg |
146 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| |||||||| || | ||||||||| |||||| ||||||||| ||||||||| |||||| |
|
|
| T |
29507215 |
ccgtgagcttaactcagttggtaggacaatgcattattatatgcaggagttgtggttcgaactccagacattccacttattcaagccactagattacctg |
29507314 |
T |
 |
| Q |
147 |
ac |
148 |
Q |
| |
|
|| |
|
|
| T |
29507315 |
ac |
29507316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 32665277 - 32665359
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||| |||||| |||||| |||||||||| ||||||| ||||| ||||| ||| | ||||||||||||||| |
|
|
| T |
32665277 |
tcccgttagcatagctcagttagtaggataatgcattattatatgcaagggtcggggttcaaactccggacaccccacttatt |
32665359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 39492833 - 39492899
Alignment:
| Q |
63 |
cagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| || | |||||||||| ||||||||||||||||| |
|
|
| T |
39492833 |
cagttgttaggacaatgcattattatatgcatgggctggggttcgaaccccagacaccccacttatt |
39492899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 43598796 - 43598858
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
|||||| ||||||| |||||| || ||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
43598796 |
ccgtgatcatagtttagttggcagagacaatgcattattatatgcagaggtcggggttcgaac |
43598858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 97
Target Start/End: Original strand, 47427725 - 47427771
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagagg |
97 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
47427725 |
gtgagcatagctccgttggtaggacaatgcattattatatgcagagg |
47427771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 64 - 129
Target Start/End: Original strand, 37279640 - 37279705
Alignment:
| Q |
64 |
agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||| ||||| |||||| |||||||||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
37279640 |
agttgatagaacaatacattattatatgcagaggttggggttcgaactccagacaccccacttatt |
37279705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 109
Target Start/End: Complemental strand, 38682352 - 38682295
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| |||||||| ||||| | |||||| |
|
|
| T |
38682352 |
tgagcatagttcatttggtaggacaatacattattatatgcaggggtcgggattcgaa |
38682295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 34407159 - 34407107
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||| ||| | |||||||||| ||||||||||||||||| |
|
|
| T |
34407159 |
atgcattattatatgcaggggttggggttcgaaccccagacaccccacttatt |
34407107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 48173284 - 48173364
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||| ||||| | ||| | ||||||||| | |||||| |||||||| |
|
|
| T |
48173284 |
ccgtgagcatagctcagttggtaagacaatgcattattatatgtatgggttggagttcgaaccccggacacctcacttatt |
48173364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 19117458 - 19117501
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
19117458 |
gtgagcatagctcagttggtaggacaatacattattatatgcag |
19117501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 20623877 - 20623794
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| ||||| || | || ||||||||| ||||||||||||||| |
|
|
| T |
20623877 |
gtcccgtgagcataactcagtttgtaggacaatgcattattatatgtagggatcagggttcgaactcaggacaccccacttatt |
20623794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 28206637 - 28206554
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||| |||| |||||||||||||||| |||||| ||||||| |||||||||| ||||| |||| |||||||||| |
|
|
| T |
28206637 |
gtcccgcgagtatagctcagttggtaggacaagacattattatatgcacgggtcgaggtttgaaccctggacatcccacttatt |
28206554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 126
Target Start/End: Complemental strand, 34898837 - 34898759
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||||||| |||||||||||||||| | | ||||| || |||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
34898837 |
cccgtgagcttagttcagttggtagggatattgcat-attatatgcaggggctgaggttcgaaccccagacaccccactt |
34898759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 129
Target Start/End: Complemental strand, 48347332 - 48347289
Alignment:
| Q |
86 |
aatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
48347332 |
aatatgcaggggtcggggttcgaacctcagacaccccacttatt |
48347289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 335127 - 335085
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatg |
91 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
335127 |
ccgtgagcatagcttagttggtaggacaatgcattattatatg |
335085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 4045729 - 4045651
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||| ||| ||||||| | |||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
4045729 |
gtgagtatagttcagttgacagggacatgcattgttatatgcaggggtcgaggttcgaacttcggacaccccacttatt |
4045651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 31917966 - 31917884
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||| |||||| |||||| ||||||| | ||||| |||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
31917966 |
tcccatgagcatagctcagtttgtaggaacatgcattgttatatgtagaggtcgggcttcgaacttcggacaccccacttatt |
31917884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 33072283 - 33072333
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
33072283 |
ttgtctcgtgagcataactcagttgataggacaatgcattattatatgcag |
33072333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 41767867 - 41767785
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| | |||||||| |||| ||||||| | | | ||||||||||||| |
|
|
| T |
41767867 |
cccgtgagcatagttcagttggcaggaacaatgcattgttatatgcaggggtcattgttcgaatctcgggcaccccacttatt |
41767785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 47191369 - 47191451
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || | ||||||||| | |||||||||||||| |
|
|
| T |
47191369 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggagttcgaaccccgaacaccccacttatt |
47191451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 97
Target Start/End: Original strand, 51399950 - 51399996
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagagg |
97 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
51399950 |
gtgagcatagctcagttggtaggatattgcattattatatgcagagg |
51399996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 129
Target Start/End: Original strand, 12711974 - 12712047
Alignment:
| Q |
57 |
atagttcagttggtaggacaatgcattataatatgcagaggtcgag-gttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| ||||||| | |||||||| ||||| | ||||||||| | ||| ||||||||||| |
|
|
| T |
12711974 |
atagttcagttggtaggaacatgcatttttatatgcaggggtcgggagttcgaacccctgactccccacttatt |
12712047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 26366316 - 26366263
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagtt-ggtaggacaatgcattataatatgcagaggt |
98 |
Q |
| |
|
||||| ||||||||| |||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
26366316 |
gtcccatgagcatagctcagtttggtaggataatgcattattatatgcagaggt |
26366263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 129
Target Start/End: Original strand, 362965 - 363021
Alignment:
| Q |
73 |
gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||||||||| | || |||||||||||| |
|
|
| T |
362965 |
gacaatgcattattatatgcaggggtcggagttcgaaccccggataccccacttatt |
363021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 2564916 - 2564964
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||| |||||||| |
|
|
| T |
2564916 |
gtcccgtgagcataactcagttggtagaacagtgcattattatatgcag |
2564964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 129
Target Start/End: Original strand, 2995208 - 2995256
Alignment:
| Q |
81 |
attataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||| ||||||| |||||||| || |||||||||||||| |
|
|
| T |
2995208 |
attattatatgcaggggtcgagattcgaacctcaaacaccccacttatt |
2995256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 4860160 - 4860239
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||| ||| |||||||||| ||| | |||||| || ||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
4860160 |
tcccgtgagcttagctcagttggtacggatattgcatttta-tatgcaggggctgaggttcgaaccccagacaccccactt |
4860239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 4880168 - 4880247
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||| ||| |||||||||| ||| | |||||| || ||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
4880168 |
tcccgtgagcttagctcagttggtacggatattgcatttta-tatgcagtggctgaggttcgaaccccagacaccccactt |
4880247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 8958358 - 8958406
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||| |||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
8958358 |
gtcctgtgagcatagctcagttggtaggataatgcattactatatgcag |
8958406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 126
Target Start/End: Original strand, 9114033 - 9114089
Alignment:
| Q |
71 |
aggacaatgcattata-atatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
9114033 |
aggacaatgcattatatatatgcaggggtcgagattcgaattccagacaccccactt |
9114089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 129
Target Start/End: Complemental strand, 18020323 - 18020267
Alignment:
| Q |
73 |
gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||| ||||| |||| |||| ||||||||||||||||| |
|
|
| T |
18020323 |
gacaatgcattattttatgcaggggtcggtgttcaaaccccagacaccccacttatt |
18020267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 28693363 - 28693303
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||||||| |||||||||| |||||| |||| ||||||||| |||| |||||||| |
|
|
| T |
28693363 |
ccgtgagcatagctcagttggtatgacaataatttattatatgcagaagtcggggttcgaa |
28693303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 121
Target Start/End: Original strand, 31576509 - 31576581
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccc |
121 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| | |||||||| ||| | || |||||| ||||||||| |
|
|
| T |
31576509 |
cgtgagcatagctcagttggtaggaacaatgcattgttatatgcaggggttggggctcgaactccagacaccc |
31576581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 34344869 - 34344829
Alignment:
| Q |
54 |
agcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
34344869 |
agcatagctcagttgataggacaatgcattattatatgcag |
34344829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 130
Target Start/End: Complemental strand, 47062150 - 47062083
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta |
130 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||| ||||||||| | ||||||||| |||||| |
|
|
| T |
47062150 |
tcagttggtaggacaatgcattattatatg-atgggtcggagttcgaaccccggacaccccatttatta |
47062083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 9e-26; HSPs: 77)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 22966058 - 22965975
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
22966058 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttatt |
22965975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 34948101 - 34948184
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| || ||||||||||||| | ||||||||||||||| |
|
|
| T |
34948101 |
gtcccgtgagcatagctcagttggtaggacaatgcattatcatatgcagtggccgaggttcgaaccccggacaccccacttatt |
34948184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 23685657 - 23685571
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| ||||||||| ||||||| |||||||||||||||| |||||||| || || |||||||||| ||||||||||||||||| |
|
|
| T |
23685657 |
attgtcccatgagcatagctcagttgataggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt |
23685571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 36316077 - 36315991
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
36316077 |
attgtcccgtgagcatagctcagttggtaggataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt |
36315991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 30644162 - 30644247
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| || || ||||||||| ||||||||||||||||| |
|
|
| T |
30644162 |
ttgtcccgtgagtatagctcagttggtaggacaatgcattattatatgcaggggccggtgttcgaaccccagacaccccacttatt |
30644247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 38778782 - 38778696
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| || |||||||| |||| | |||| |||||||||| |
|
|
| T |
38778782 |
attgtcccgtgagcatatctcagttggtaggacaatgcattattatatgcaggggccgaggttctaaccccggacatcccacttatt |
38778696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 46 - 128
Target Start/End: Complemental strand, 44437925 - 44437843
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
44437925 |
gtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
44437843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 46716334 - 46716411
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
46716334 |
tgagcatagctcagttggtaggacaatgcattattatatgcagaggtcggggttcgaaccctgaacaccccacttatt |
46716411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 42887148 - 42887232
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| |||||| |||||||| || |||||||||||| | ||||||||||||||| |
|
|
| T |
42887148 |
tgtcccgtgagcatagctcagttggtacgacaattcattattatatgcaggggctgaggttcgaaccccggacaccccacttatt |
42887232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 2366350 - 2366435
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||||||||| |||||||| ||||| ||||||||| |||||||||||||||| |
|
|
| T |
2366350 |
ttgtcccgtgagtataactcagttgataggacaatgcattattatatgcaggggtcggggttcgaactctagacaccccacttatt |
2366435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 27047809 - 27047732
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||| ||||| |
|
|
| T |
27047809 |
tgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccatttatt |
27047732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 46337968 - 46337903
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||| | ||| |||||||||| |
|
|
| T |
46337968 |
gtcccgtgaacatagttcagttggtaggacaatgcattattatatgcagggatcggggttcgaacc |
46337903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 47552212 - 47552291
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| || || |||||||||| | ||||||| ||||||| |
|
|
| T |
47552212 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggggttcgaaccccggacaccctacttatt |
47552291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 5787457 - 5787539
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||||||| |||||||| || || |||| ||||| || |||||||||||||| |
|
|
| T |
5787457 |
tcccgtgagtatagctcaattggtaggacaatgcattattatatgcaggggccggggtttgaaccccaaacaccccacttatt |
5787539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 41417374 - 41417292
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| |||| || ||||| || |||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
41417374 |
cccgtgagcatagctcagttggcaggaacagtgcatcattatatgcaggggtcggggttcgaaccccagacaccccacttatt |
41417292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 56 - 129
Target Start/End: Original strand, 8724385 - 8724458
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
8724385 |
catagttcagttggtaggataatacattattatatgcagaggtcgggaatcgaacctcggacaccccacttatt |
8724458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 49012391 - 49012476
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| || |||| ||||| || ||||||||| ||||||| |
|
|
| T |
49012391 |
ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgaaggggtcagggttcaaattccagacaccctacttatt |
49012476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 2261581 - 2261501
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |||||||| || || |||||||| | | ||||||| ||||||| |
|
|
| T |
2261581 |
ccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaatcccggacacccaacttatt |
2261501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 109
Target Start/End: Original strand, 8195909 - 8195973
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||| ||| || || |||||||| |
|
|
| T |
8195909 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatccaggggccggggttcgaa |
8195973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 126
Target Start/End: Complemental strand, 14967734 - 14967654
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| ||||| || ||||| |||| ||||| |||||||| ||||| |
|
|
| T |
14967734 |
gtcctgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactt |
14967654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 126
Target Start/End: Complemental strand, 15397210 - 15397130
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| ||||| || ||||| |||| ||||| |||||||| ||||| |
|
|
| T |
15397210 |
gtcctgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactt |
15397130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 17900979 - 17900896
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||| |||||||| || || || ||||||| | ||| ||||||||||| |
|
|
| T |
17900979 |
gtcccatgagcatagcttagttggtaggacaatgcattattatatgcaggggccggggctcgaaccccggactccccacttatt |
17900896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 21086099 - 21086182
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||| ||||| |||||||||||||||||||||||| |||||||| | |||| |||||||| | ||||||| ||||||| |
|
|
| T |
21086099 |
gtcccatgaacatagctcagttggtaggacaatgcattattatatgcagggatcgaagttcgaactccggacacccaacttatt |
21086182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 22706128 - 22706045
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||| |||||||| || ||||||| ||| | ||||||||||||||| |
|
|
| T |
22706128 |
gtcccgtgaacatagctcagttggtaggacaatgtattattatatgcaggggctgaggttcaaactccggacaccccacttatt |
22706045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 30152740 - 30152819
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| |||| || ||||| |||||||||| | |||||||||||||| |
|
|
| T |
30152740 |
cgtgagcttagctcagttggtaggacaatgcattattatatataggggtcggggttcgaaccccgaacaccccacttatt |
30152819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 31694066 - 31694148
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||| ||||||||| |||||||||||||| |||||||| || |||| ||||||| | ||||||||||||||| |
|
|
| T |
31694066 |
gtcccgtgaacatagctcagttggt-ggacaatgcattattatatgcaggggacgagattcgaactccggacaccccacttatt |
31694148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 45198198 - 45198115
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||| |||||||| | | ||| |||||||| | ||||||||| ||||| |
|
|
| T |
45198198 |
gtcccgtgagcataactcagttggtaggataatgcattattatatgcagtgattgagattcgaaccccggacaccccatttatt |
45198115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 55 - 129
Target Start/End: Complemental strand, 924383 - 924309
Alignment:
| Q |
55 |
gcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||||||||| | |||||||| ||||| || ||| | |||||||||| ||||||||||||||||| |
|
|
| T |
924383 |
gcatagctcagttggtaggatagtgcattattatatgtaggggttggggttcgaaccccagacaccccacttatt |
924309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 127
Target Start/End: Original strand, 4818015 - 4818097
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgc-agaggtcgaggttcgaaccgcagacaccccactta |
127 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |||||| | || || ||||||||| ||||||||||||||| |
|
|
| T |
4818015 |
gtcccgtgagcatcgctcagttggtaggacaatgcattattatatgcggggggccgtggttcgaactccagacaccccactta |
4818097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 7263099 - 7263033
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| ||||| |||||| | ||||||||| |
|
|
| T |
7263099 |
tgtcccgtgagtatagctcagttggtaggacaatgcattattatatgtagaggttggagttcgaacc |
7263033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 14818464 - 14818382
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||| |||||||| |||||||| ||||| ||||| |||| || |||||||||||||| |
|
|
| T |
14818464 |
cccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttatt |
14818382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 15265462 - 15265380
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||| |||||||| |||||||| ||||| ||||| |||| || |||||||||||||| |
|
|
| T |
15265462 |
cccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttatt |
15265380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 21285452 - 21285370
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||| | |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
21285452 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttatt |
21285370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 22741198 - 22741283
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc--gaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |||||||| ||| | |||||||| | | ||||||||||||||| |
|
|
| T |
22741198 |
gtcccgtgagcatagctcggttggtaggacaatgcattattatatgcagtagtcagggggttcgaatctcggacaccccacttatt |
22741283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 43970953 - 43970888
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| ||||||||| | || |||||||||| |
|
|
| T |
43970953 |
gtcccgtgagcataactcagttggtagaacaatgcattattatatgcagaagacggggttcgaacc |
43970888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 129
Target Start/End: Complemental strand, 45011740 - 45011675
Alignment:
| Q |
64 |
agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| | |||||||||| | || |||||||||||| |
|
|
| T |
45011740 |
agttggtaggacaatgcattattatatgcagaggccagggttcgaacctcggagaccccacttatt |
45011675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 110
Target Start/End: Original strand, 21925470 - 21925534
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||| || |||||| |||| |||| |
|
|
| T |
21925470 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatacataggtcggggtttgaac |
21925534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 25711232 - 25711148
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||| ||||||| ||||| |||||||||| ||||| || || || |||||||||| | ||||||||||||||| |
|
|
| T |
25711232 |
tgtcccgtgagtataactcagttgataggataatgcattattatatgtaggggccggggttcgaacctcggacaccccacttatt |
25711148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 110
Target Start/End: Original strand, 29778976 - 29779040
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |||||||||| |||||||| ||||| |||||||| |
|
|
| T |
29778976 |
gtcccgtgagcatagctcaattggtaggataatgcattattatatgcaggggtcggagttcgaac |
29779040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 32814825 - 32814905
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| |||||||| ||||| ||||||| | | ||||||||||||||| |
|
|
| T |
32814825 |
ccgtgagcatagctcagttggtagggacatgcattattatatgcaggggtcggagttcgaatcccggacaccccacttatt |
32814905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 34962072 - 34962024
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
34962072 |
gtcctgtgagcatagctcagttggtaggacaatgcattattatatgcag |
34962024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 110
Target Start/End: Complemental strand, 35919771 - 35919707
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||||||||| ||||| | ||||||| |||||||| |
|
|
| T |
35919771 |
gtcccgtgagcatagctcagttgttaagacaatgcattattatatgtaaaggtcgaagttcgaac |
35919707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 4590701 - 4590658
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
4590701 |
gtgagcatagctcagttggtaggacaatgcattattatatgcag |
4590658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 7908705 - 7908787
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||| ||||| |||||||||||||| |||||||| ||||||||||| |||||||||||| || |||||| ||||||| |
|
|
| T |
7908705 |
gtcctgtgaacatagcacagttggtaggaca-tgcattattatatgcagaggctgaggttcgaaccccaaacaccctacttatt |
7908787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 19126740 - 19126815
Alignment:
| Q |
55 |
gcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||| ||| || |||||||||||| | ||||||||||||||| |
|
|
| T |
19126740 |
gcatagctcagttggtaggaacaatgcattattatatacaggggctgaggttcgaaccccggacaccccacttatt |
19126815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 22047520 - 22047563
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
22047520 |
gtgagcatagctcagttggtaggacaatgcattattatatgcag |
22047563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 29710200 - 29710118
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| ||||| || || ||||||||||| |||||| ||||||||| |
|
|
| T |
29710200 |
gtcccgtgagtatagctcagttggtaggacaatgcattattatatgtag-ggctgaggttcgaactctagacactccacttatt |
29710118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 31475940 - 31475857
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||| |||||||| |||||||| || | |||||||||| | ||||||||||||||| |
|
|
| T |
31475940 |
tcccgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttatt |
31475857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 8725240 - 8725155
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| |||||| |||| |||||||||||||| ||||||||| |||||||| | || |||||||||| | |||||||||||||| |
|
|
| T |
8725240 |
attgtctcgtgagaatagctcagttggtaggacgatgcattattatatgcag-gaccggggttcgaaccccgaacaccccacttatt |
8725155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 11808034 - 11808116
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||| ||| |||||||| ||||||| | |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
11808034 |
tcccgtgagcttagctcaattggtagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt |
11808116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 126
Target Start/End: Original strand, 24188471 - 24188548
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||||| |||||||||||| | | ||||| || |||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcat-attatatgcaggggtcggggttcgaaccccagacaccccactt |
24188548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 29658371 - 29658289
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| |||| || ||||||||||| | |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
29658371 |
cccgtgagcatagctcaattggcagcgacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttatt |
29658289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 109
Target Start/End: Original strand, 41139083 - 41139145
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
41139083 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaa |
41139145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 85
Target Start/End: Original strand, 45197314 - 45197352
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattat |
85 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45197314 |
tcccgtgagcatagctcagttggtaggacaatgcattat |
45197352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 127
Target Start/End: Original strand, 7465462 - 7465542
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta |
127 |
Q |
| |
|
|||||||||||||| |||||||| || |||| |||||||| |||||||| || || |||||||||| | ||||||||||||| |
|
|
| T |
7465462 |
tcccgtgagcatagctcagttggcagagaca-tgcattattatatgcaggggccggggttcgaaccccggacaccccactta |
7465542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 37917389 - 37917470
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| || |||||||| ||| | ||||| |||| | |||||||||||||| |
|
|
| T |
37917389 |
cccgtgagcatagctcagttggtaggaacatgcataattatatgcaggggttggggttcaaaccctaaacaccccacttatt |
37917470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 43635585 - 43635666
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||| || | ||||||| | |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
43635585 |
cccgtgagcataactcagttggcagaaacatgcattgttatatgcagcggtcggggttcgaaccccggacaccccacttatt |
43635666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 4104474 - 4104522
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||||||||||| ||||||| |
|
|
| T |
4104474 |
tgtcccgtgagcatagctcaattgttaggacaatgcattattatatgca |
4104522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 90
Target Start/End: Complemental strand, 25087050 - 25087006
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatat |
90 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
25087050 |
gtcccgtgagcatagtttagttcgtaggacaatgcattattatat |
25087006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 25818281 - 25818329
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
25818281 |
gtcccgtgagcataactcagttggtaggataatgcattattatatgcag |
25818329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 13905526 - 13905443
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||| ||| ||| || || ||||||||| ||||||| |||||||| |
|
|
| T |
13905526 |
gtcccgtgaacatagctcagttggtaggacaatgtattattataaacaggggccggagttcgaaccctagacaccacacttatt |
13905443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 22660736 - 22660819
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||| | ||||| || || || |||||||||| || |||||||||||||| |
|
|
| T |
22660736 |
tcccgtgagcatagttcagttgacagggataatgcattgttatatgtaggggccggggttcgaaccccaaacaccccacttatt |
22660819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 24396956 - 24397023
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| ||||| ||||||||| ||||||| ||||||| |
|
|
| T |
24396956 |
tcagttggcaggacaatgcattattatatgcaggggtcggagttcgaaccctggacaccctacttatt |
24397023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 27907980 - 27907913
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || || ||| ||| | | ||||||||||||||| |
|
|
| T |
27907980 |
tcagttggtaggacaatgcattattatatgcaggggccggggtaagaatctcggacaccccacttatt |
27907913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 38025336 - 38025419
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||| ||| ||| |||||||||||||||| |||||||| || | |||||||||| | |||| ||||||||| |
|
|
| T |
38025336 |
gtcctgtgagcatagctcatttgataggacaatgcattattatatgcaggagttggggttcgaacctcggacattccacttatt |
38025419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 42260130 - 42260048
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||||| ||||||||| |||||||||||| |||| || ||||| ||||||||| || ||| |||||||||| |
|
|
| T |
42260130 |
gtcccgtgagtatagttaagttggtagaacaatgcattattatatataggggtcggagttcgaacccca-acatcccacttatt |
42260048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 109
Target Start/End: Original strand, 48082195 - 48082258
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||| | ||||||||||||| |||| ||||||| ||||| || |||||||||||||| |
|
|
| T |
48082195 |
tcccgtgagcacaattcagttggtaggaacaacgcattattatatgtaggggtcgaggttcgaa |
48082258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 109
Target Start/End: Complemental strand, 28735292 - 28735235
Alignment:
| Q |
52 |
tgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
28735292 |
tgagcataattcagttggtaaggacaatgcataata-tatgcagaggtcgaagttcgaa |
28735235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 36176863 - 36176949
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| || ||| ||||| |||||||||||||||||||||||| ||||| || || |||||| |||| | |||||| |||||||| |
|
|
| T |
36176863 |
attgttccatgaacatagctcagttggtaggacaatgcattattatatgtaggggctaaggttcaaaccccggacacctcacttatt |
36176949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 38792212 - 38792290
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| |||||||| |||| ||| ||||| | ||||||| ||||||| |
|
|
| T |
38792212 |
gtgagcatgattcagttggtaagacaatgcattattatatgcaggggtcagagtttgaaccccggacaccctacttatt |
38792290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 45417466 - 45417516
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||| ||||| |||||||| |
|
|
| T |
45417466 |
ttgtcccgtgagcatagctcagttggcagaacaatgtattattatatgcag |
45417516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7392404 - 7392323
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| |||| |||| ||||||| | |||||||||||| | |||| ||||| | |||||||||||||| |
|
|
| T |
7392404 |
cccgtgagcatagctcaattggcaggaacatgcattgttatatgcagaggttggggtttgaaccccgaacaccccacttatt |
7392323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 126
Target Start/End: Original strand, 22590671 - 22590738
Alignment:
| Q |
58 |
tagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||||||| ||||| |||| ||| |||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
22590671 |
tagttcagttggtagggacattgca-tattatatacagaggtcggggttcgaacc-cagacaccccactt |
22590738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 121
Target Start/End: Original strand, 30741557 - 30741634
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccc |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||| | |||||||| || || ||||||||| | ||||||| |
|
|
| T |
30741557 |
ttgtcccgtgagcataactcagttggtaggataatgtattgttatatgcaggggccggtgttcgaaccccggacaccc |
30741634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 37410578 - 37410498
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggt-aggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||||||| | |||||||| |||| |||||||||| | |||||| |||||||| |
|
|
| T |
37410578 |
ccgtgagcatagctcagttggtaaggac-atgcattgttatatgcaggggtcaaggttcgaactccggacacctcacttatt |
37410498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 10474608 - 10474529
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||||||| ||| || |||| | |||||||| ||||| ||||||| || | |||||| |||||||| |
|
|
| T |
10474608 |
cgtgagcatagttcagttggtagagac-atacattgttatatgcaggggtcggggttcgacccccggacacctcacttatt |
10474529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 24579355 - 24579303
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||| || ||| |||||||| ||||||||||||||||| |
|
|
| T |
24579355 |
atgcattattatatgcaggggatgagattcgaaccccagacaccccacttatt |
24579303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 9e-26; HSPs: 66)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 19642647 - 19642564
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
19642647 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcatcggtcggggttcgaaccccagacaccccacttatt |
19642564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 32057029 - 32057112
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||| |
|
|
| T |
32057029 |
gtcccgtgagcatagctcagttgataggacaatgcattattatatgcagtggtcgaggttcgaaccccagagatcccacttatt |
32057112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 22389852 - 22389767
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| |||| |||||||| | | ||||||||||||||| |
|
|
| T |
22389852 |
ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcagggttcgaatcccggacaccccacttatt |
22389767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 10377225 - 10377141
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| ||||||||||| || |||||||||| | |||||||||||||| |
|
|
| T |
10377225 |
tgtcccgtgagtatagctcagttggtaggacaatgcattattatatgcagaggccggggttcgaaccccgaacaccccacttatt |
10377141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 12089091 - 12089175
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| || || ||||||||| | ||||||||||||||| |
|
|
| T |
12089091 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttatt |
12089175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 30566053 - 30566136
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||| || ||| ||||| | ||||||||||||||| |
|
|
| T |
30566053 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttatt |
30566136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 9491836 - 9491752
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| || || || |||||||||| | ||||||||||||||| |
|
|
| T |
9491836 |
tgtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacaccccacttatt |
9491752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 34365729 - 34365813
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||| || || |||||||||| | |||| ||||||||| |
|
|
| T |
34365729 |
tgtcccgtgagcatagttcagttggtaggacaatgcattattatgtgcaggggccggggttcgaacctcgaacactccacttatt |
34365813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 7563676 - 7563593
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| | |||||| |||| ||||| |||| | ||||||||||||||| |
|
|
| T |
7563676 |
gtcccgtgagcatagctcagttggtaggacaatgcattattacatgcaggggtcagggttcaaaccccggacaccccacttatt |
7563593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9064862 - 9064944
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| ||||||||||||||||| |
|
|
| T |
9064862 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt |
9064944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 46 - 148
Target Start/End: Original strand, 10373590 - 10373691
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttattagccactaggctacct |
145 |
Q |
| |
|
|||||||||||||| | ||||||||| |||||||||||| |||||||| ||||| |||||||||| | ||||||| | || ||||||||||||||||| |
|
|
| T |
10373590 |
gtcccgtgagcataacttagttggtagaacaatgcattattatatgcaggggtcggggttcgaaccccggacacccgaatt-ctagccactaggctacct |
10373688 |
T |
 |
| Q |
146 |
gac |
148 |
Q |
| |
|
||| |
|
|
| T |
10373689 |
gac |
10373691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 18244112 - 18244047
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||| ||| ||||| |||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
18244112 |
gtcccatgaacatagctcagttggtaggacaatgcattattatatgcagaggtcggggttcgaacc |
18244047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 12128005 - 12127926
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||| | ||||| ||||||||| |
|
|
| T |
12128005 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggaattcgaaccccggacacgccacttatt |
12127926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 15289051 - 15288972
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| || || | ||||||||| ||||||||||||||||| |
|
|
| T |
15289051 |
cgtgagcatagttcagttggtaggacattgcattattatatgtaggggctggggttcgaactccagacaccccacttatt |
15288972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 19165362 - 19165428
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| | |||||||||| | ||||||||||||||| |
|
|
| T |
19165362 |
tcagttggtaggacaatgcattattatatgcagaggttggggttcgaacc-ccgacaccccacttatt |
19165428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 48 - 126
Target Start/End: Complemental strand, 25064767 - 25064689
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| |||||||| ||| | |||||||||| |||||||||||||| |
|
|
| T |
25064767 |
cccgtgagcatagttcagttggtatggaca-tgcattattatatgcaggggttggggttcgaaccccagacaccccactt |
25064689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 5134533 - 5134451
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||||| |||||||| || ||||||||||| | ||||||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
5134533 |
cccgtaagcatagctcagttggcagagacaatgcattgttatatgcagaggccgcggttcgaacctcagacaccccacttatt |
5134451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 35190759 - 35190841
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||| |||||||| ||||| ||||||||| | |||||||||||||| |
|
|
| T |
35190759 |
tcccatgagcatagctcagttggtagaacaatgcattattatatgcaggggtcggagttcgaaccccgaacaccccacttatt |
35190841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 110
Target Start/End: Original strand, 8233081 - 8233145
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| |||| |||||||| ||||||||| |
|
|
| T |
8233081 |
gtcccgtgagcatagctcagttggtaggacaatacattattatatacagaggtcagggttcgaac |
8233145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 34396078 - 34396126
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
34396078 |
gtcccgtgagcatagttcagttggtacgacaatgcattattatatgcag |
34396126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 48 - 130
Target Start/End: Original strand, 2945592 - 2945675
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta |
130 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||| | |||||||| ||||| ||||| |||| | |||||||||||||||| |
|
|
| T |
2945592 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcaaacctcggacaccccacttatta |
2945675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 125
Target Start/End: Original strand, 9438313 - 9438376
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccact |
125 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| | |||||||||| | ||||||||||| |
|
|
| T |
9438313 |
tcagttggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacaccccact |
9438376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 18631467 - 18631550
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| |||| | |||||||| ||||| | |||||||| || | |||||||||||| |
|
|
| T |
18631467 |
gtcctgtgagcatagctcagttggtaggacaatacattgttatatgcaggggtcgggattcgaaccccaaataccccacttatt |
18631550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21507301 - 21507218
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||| |||||||| ||||| ||| |||| | ||||||||||||||| |
|
|
| T |
21507301 |
gtcccgtgagcatagcttagttggtaggacaatgtattattatatgcaggggtcggagtttgaactccggacaccccacttatt |
21507218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 6143961 - 6144042
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| ||||| || ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
6143961 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgtaggggtcg-ggttcgaaccccggacaccccacttatt |
6144042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 126
Target Start/End: Original strand, 11982755 - 11982836
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||| |||||||| ||||||||||| | |||||||||| |||||||| ||||| |||| ||||| | |||||||||||| |
|
|
| T |
11982755 |
ttgtcccgggagcatagctcagttggtagaataatgcattattatatgcaggggtcg-ggtttgaaccccggacaccccactt |
11982836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 14981801 - 14981719
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| ||||||||||||||| |
|
|
| T |
14981801 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttatt |
14981719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 22501012 - 22501066
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc |
99 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
22501012 |
tgtcccatgagcatagctcagttggtaggacaatgcattattatatgcaggggtc |
22501066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 5288442 - 5288381
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
5288442 |
ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggtccgaac |
5288381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 16269819 - 16269734
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||||||||| || |||||||||||| |||||||| |||||||| ||| |||| ||||||| | || ||||||||||| |
|
|
| T |
16269819 |
ttgtctcgtgagcatagctcggttggtaggacagtgcattattatatgcaggggttgaggatcgaaccccgaacgccccacttatt |
16269734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 20716482 - 20716409
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||| || ||||| | ||||||| |||| |||||||||||| |
|
|
| T |
20716482 |
catagctcagttggtaggacaatgcattattatatgtaggggtcgggattcgaactccagataccccacttatt |
20716409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 25020622 - 25020545
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||| |||||||| || | |||||||||| | ||||||||||||||| |
|
|
| T |
25020622 |
tgagcatagctcagctggtaggacgatgcattattatatgcaggggcctgggttcgaaccccggacaccccacttatt |
25020545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 129
Target Start/End: Original strand, 26528580 - 26528645
Alignment:
| Q |
64 |
agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||||| ||||| |||| | ||||||||||||||| |
|
|
| T |
26528580 |
agttggtagaacaatgcattattatatgcaggggtcggggttcaaacctcggacaccccacttatt |
26528645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 30833018 - 30833095
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| | |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
30833018 |
tgagcatagttcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttatt |
30833095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 12291164 - 12291248
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||| ||||| || ||| |||||| |||| ||||||||||| ||||| |
|
|
| T |
12291164 |
tgtcccgtgagcataactcagttgttagaacaatgcattattatatggaggggttgaggttagaacgccagacaccccatttatt |
12291248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 34792942 - 34792879
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
34792942 |
tcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggtctgggttcgaacc |
34792879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 109
Target Start/End: Original strand, 16801784 - 16801847
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |||||||| |||| |||||||| |
|
|
| T |
16801784 |
gtcccgtgagcatagctcagttggtaggacaaaacattattatatgcaggagtcggggttcgaa |
16801847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 19417817 - 19417900
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||||||| || |||||||||| |||| ||||| |||||||| | ||| | |||||| | ||||||||||||||||| |
|
|
| T |
19417817 |
gtcccgtaagcatagctctgttggtaggataatgtattattatatgcagggatcgggattcgaatcccagacaccccacttatt |
19417900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 111
Target Start/End: Original strand, 7303786 - 7303852
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| |||||||||||| | | |||||||| |
|
|
| T |
7303786 |
tgtcccgtgagcataactcagttggtaggacaatatattattatatgcagaggttgggattcgaacc |
7303852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 122
Target Start/End: Original strand, 10455739 - 10455813
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc |
122 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| | |||||||| || || |||||||||| | |||||||| |
|
|
| T |
10455739 |
cccgtgagcatagttcagttggcaggaacatgcattgttatatgcaggggccggggttcgaaccccggacacccc |
10455813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 24256913 - 24256994
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||||||||||| |||| |||||||| |||||||| || ||||||||||||| | || |||||||||||| |
|
|
| T |
24256913 |
cccgtgagcataagtcagttggtagagaca-tgcattattatatgcaggggccgaggttcgaaccccggataccccacttatt |
24256994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 108
Target Start/End: Original strand, 24623517 - 24623579
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga |
108 |
Q |
| |
|
||||| ||| ||||| |||||||||||||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
24623517 |
gtcccatgaacatagctcagttggtaggacaatgcattattatatgcaagggtcggggttcga |
24623579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 129
Target Start/End: Complemental strand, 753402 - 753329
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| | ||||||||||||| |||||| ||||| || ||||| |||||||||| ||||||||||||||| |
|
|
| T |
753402 |
catagtttaattggtaggacaatacattattatatgtaggggtcggggttcgaaccctggacaccccacttatt |
753329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 6025486 - 6025421
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||| |||||||| ||||| | |||||||| |
|
|
| T |
6025486 |
gtcccgtaagcataactcagttggtaggataatgcattattatatgcaggggtcgggattcgaacc |
6025421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 127
Target Start/End: Original strand, 7392537 - 7392614
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta |
127 |
Q |
| |
|
||||| ||||| |||||| |||||| |||||||||| ||||||| |||| | | |||||||| || |||||||||||| |
|
|
| T |
7392537 |
cgtgaacatagctcagttagtaggataatgcattattatatgcaaaggttgggattcgaacctcaaacaccccactta |
7392614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 26669757 - 26669676
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| || ||||| || || | |||||||||| ||||||||||||||||| |
|
|
| T |
26669757 |
cccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttatt |
26669676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 26878801 - 26878858
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| |||||||| ||| | |||||||| |
|
|
| T |
26878801 |
tgagcataattcagttggtaagacaatgcattattatatgcaggggttgtggttcgaa |
26878858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 34521988 - 34522053
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| |||| ||| || || ||||||||| |
|
|
| T |
34521988 |
gtcccgtgagcatagtccagttggtaggacaatgaattattatatccaggggacggagttcgaacc |
34522053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 106
Target Start/End: Complemental strand, 17419797 - 17419737
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttc |
106 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| ||||| |||||||| ||| ||||||| |
|
|
| T |
17419797 |
gtcccgtgagcatagctcagttagtaggacaatatattattatatgcaggggttgaggttc |
17419737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 108
Target Start/End: Original strand, 18991477 - 18991541
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcga |
108 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||| ||||| || || || ||||||| |
|
|
| T |
18991477 |
ttgtcccgcgagcatagctcagttggtaagacaatgcattattatatgtaggggccggggttcga |
18991541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 126
Target Start/End: Complemental strand, 34432868 - 34432789
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
|||||||||| |||||||||||||||| | | ||||| || |||||||||||| | |||||||||| ||||||| |||||| |
|
|
| T |
34432868 |
tcccgtgagcttagttcagttggtagggatattgcat-attatatgcagaggttggggttcgaaccccagacactccactt |
34432789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 6530300 - 6530221
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgca-ttataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||| |||||||| || || ||||| |||| | ||||||||||||||| |
|
|
| T |
6530300 |
gtgagcataaatcagttggtagaacaatgcaattattatatgcaggggccggggttcaaacctcggacaccccacttatt |
6530221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 16251619 - 16251540
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| | |||||||||||||||||| || |||||||| ||||| |||||||| | ||||||||||||||| |
|
|
| T |
16251619 |
cgtgagcataacttagttggtaggacaatgcacaattatatgcaggggtcgttgttcgaactccggacaccccacttatt |
16251540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Original strand, 22983599 - 22983658
Alignment:
| Q |
70 |
taggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
22983599 |
taggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
22983658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 129
Target Start/End: Original strand, 23771036 - 23771111
Alignment:
| Q |
54 |
agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| |||||||| || | ||||||||| | ||||||||| ||||| |
|
|
| T |
23771036 |
agcatagctcaattggtaggacaatgcattattatatgcaggggaaggggttcgaactccggacaccccatttatt |
23771111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Complemental strand, 23804809 - 23804750
Alignment:
| Q |
70 |
taggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
23804809 |
taggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
23804750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 91
Target Start/End: Complemental strand, 31741557 - 31741518
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatg |
91 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
31741557 |
tgagcatagctcagttggtaggacaatgcattattatatg |
31741518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 2044710 - 2044648
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
2044710 |
ccgtgagtttagttcagttggtatagacaatgcataataatatgcagaggtcggagttcgaac |
2044648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 3448348 - 3448430
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| |||| ||| |||||||||| | ||| |||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
3448348 |
cccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttatt |
3448430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 12101898 - 12101964
Alignment:
| Q |
63 |
cagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| || || ||||||||| | ||||||| ||||||| |
|
|
| T |
12101898 |
cagttggtaggacaatacattattatatgcaggggccggcgttcgaaccccggacaccctacttatt |
12101964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 20568355 - 20568274
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||| |||||||||| ||||| ||||| ||| ||||||| ||||| |||||||||| | |||||||||||||| |
|
|
| T |
20568355 |
cccgtgagcttagctcagttggtaaggacattgcataata-tatgcaggggtcggggttcgaaccccgaacaccccacttatt |
20568274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 29284118 - 29284196
Alignment:
| Q |
52 |
tgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||||| ||||| || | ||| |||||||||| | ||||||||||||||| |
|
|
| T |
29284118 |
tgagcataactcagttggtaggaacaatgtattattatatgtagggatcggggttcgaaccccggacaccccacttatt |
29284196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 6219351 - 6219431
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||||| |||||||| ||| ||||||||| |||| ||| ||||| | |||||||| ||||||||||||||||| |
|
|
| T |
6219351 |
cccgtgaacatagctcagttggcagggacatgcattattatatacagtggtcg-gattcgaaccccagacaccccacttatt |
6219431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 10424636 - 10424552
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||| ||||||| ||| |||||||||||| ||||| || ||||| |||| ||| | | ||||||||||||||| |
|
|
| T |
10424636 |
ttgtctcgtgagcataactcagttgatag-acaatgcattattatatgtaggggtcgtggtttgaatcccggacaccccacttatt |
10424552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 126
Target Start/End: Original strand, 11636685 - 11636738
Alignment:
| Q |
73 |
gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||||||||| | |||||||||||| |
|
|
| T |
11636685 |
gacaatgcattattatatgcaggggtcggagttcgaaccccggacaccccactt |
11636738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Original strand, 1488114 - 1488166
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| | |||||||||||||| |||||||||| || |||||||| ||||| |
|
|
| T |
1488114 |
atgcattgttatatgcagaggtcggggttcgaaccccaaacaccccatttatt |
1488166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 83)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 9524950 - 9525035
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| ||||||||| ||||||| |
|
|
| T |
9524950 |
ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttatt |
9525035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 15042465 - 15042382
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
15042465 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
15042382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 24608583 - 24608500
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| ||||||||| ||||||| |
|
|
| T |
24608583 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttatt |
24608500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 42 - 128
Target Start/End: Original strand, 17980273 - 17980359
Alignment:
| Q |
42 |
cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
17980273 |
cattgtcccgtgagcatagctcagttggtaggacaaagcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
17980359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 13762614 - 13762529
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||| | ||||||||||||||| |
|
|
| T |
13762614 |
ttgtcctgtgagcatagttcagttggtaggacaatgcattattatatgcaggggtcagtgttcgaaccacggacaccccacttatt |
13762529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 34073340 - 34073256
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||| ||||| || |||| ||||||||||| | ||||||||||||||| |
|
|
| T |
34073340 |
tgtcccgtgagcgtagttcagttggtaggataatgcattattatatgtaggggtcaaggttcgaaccccggacaccccacttatt |
34073256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 2376513 - 2376596
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||| |||| |||||||||| | ||||| ||||||||| |
|
|
| T |
2376513 |
gtcccgtgagcatagttcaattggtaggacaatgcattattatatgcaggggtccgggttcgaacctcggacactccacttatt |
2376596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 4798644 - 4798558
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
4798644 |
attgtcccgtgagtatagctcagttggtaggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
4798558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 42688049 - 42688134
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||| || ||||| | |||||||| | |||||||||||||| |
|
|
| T |
42688049 |
ttgtctcgtgagcatagttcagttggtaggacaatgcattattatatgtaggggtcgggattcgaaccccgaacaccccacttatt |
42688134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 44 - 128
Target Start/End: Original strand, 43847695 - 43847779
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||| |
|
|
| T |
43847695 |
ttgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttat |
43847779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 125
Target Start/End: Original strand, 25119203 - 25119282
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccact |
125 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||| ||| | |||||||||| | |||| |||||| |
|
|
| T |
25119203 |
gtcccgtgagcatagttcaattggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacatcccact |
25119282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 39484470 - 39484387
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||| | ||||||||||||||| |
|
|
| T |
39484470 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaatgccggacaccccacttatt |
39484387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 43468805 - 43468722
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| | ||||| || ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
43468805 |
gtcccgtgagcatagctcagttggtaggacaatgcattgttatatgtaggggtcggggttcgaactccggacaccccacttatt |
43468722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 23857425 - 23857340
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca-gaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||| | || || |||||||||| | ||||||| ||||||| |
|
|
| T |
23857425 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcagggggccggggttcgaacctcggacacccgacttatt |
23857340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 9737461 - 9737377
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||| |||| || || |||||||||||| | ||||||||||||||| |
|
|
| T |
9737461 |
tgtcccgtgagcatagctcagttggtaggacaatacattattatatataggggccgaggttcgaactccggacaccccacttatt |
9737377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 27558970 - 27558888
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| |||||||||| |||||||| ||||| | |||||||| ||||||||||||||||| |
|
|
| T |
27558970 |
gtcccgtgagcgtagctcatttggtaggataatgcattattatatgcaggggtcgggattcgaacc-cagacaccccacttatt |
27558888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 2800015 - 2800097
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
2800015 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
2800097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 45 - 127
Target Start/End: Complemental strand, 25689489 - 25689407
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta |
127 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| |||||||| ||||| || || ||||||||||||| | ||||||| ||||| |
|
|
| T |
25689489 |
tgtctcgtgagcatagctcagttggtaggacactgcattattatatgtaggggccgaggttcgaaccccggacaccctactta |
25689407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 6064370 - 6064455
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| ||| ||||| |||||||||||||| |||||||| ||||| |||||||||| | ||||| |||||||| |
|
|
| T |
6064370 |
ttgtcccgtgagcttagctcaattggttggacaatgcattattatatgcaggggtcggggttcgaacctcggacacttcacttatt |
6064455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 14010874 - 14010789
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||| |||| |||||||| ||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
14010874 |
ttgtcccgtgagcatagctcagttggtaagacagtgcattattatatgttatggtcggggttcgaaccccggacaccccacttatt |
14010789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 5184988 - 5184904
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| ||||| |||||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
5184988 |
tgtcctgtgagcatagctcagttggtaggacaatggattattatatgcaggggctggggttcgaaccctggacaccccacttatt |
5184904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 17987550 - 17987466
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| |||||||||| |||||||| || || ||||||||| | ||||||||| ||||| |
|
|
| T |
17987550 |
tgtcccgtgaacatagctcagttggtaggataatgcattattatatgcaggggccggagttcgaaccccggacaccccaattatt |
17987466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 28465613 - 28465661
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28465613 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcag |
28465661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 10199826 - 10199759
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||| || || |||||||||| || |||||||||||||| |
|
|
| T |
10199826 |
tcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccaaacaccccacttatt |
10199759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 44 - 91
Target Start/End: Complemental strand, 41225767 - 41225720
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatg |
91 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
41225767 |
ttgtcccgtgagcatagctcagttggtaggacaatgcattattatatg |
41225720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 2696529 - 2696611
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
2696529 |
cccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
2696611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 43 - 129
Target Start/End: Original strand, 7649521 - 7649606
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| ||||| || || | |||||||||| | |||||||||||||| |
|
|
| T |
7649521 |
attgtcccgtgagcatagctcacttggtaggacaatgcattattatatgtag-ggctggggttcgaacctcgaacaccccacttatt |
7649606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 10292348 - 10292430
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || ||| |||||||| | ||||||||||||||| |
|
|
| T |
10292348 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctgagattcgaacctcggacaccccacttatt |
10292430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 94
Target Start/End: Complemental strand, 40249982 - 40249932
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
40249982 |
ttgtcccgtgagcataactcagttggtaggacaatgcattattatatgcag |
40249932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 91
Target Start/End: Original strand, 29108657 - 29108702
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatg |
91 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
29108657 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatg |
29108702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 127
Target Start/End: Complemental strand, 35556486 - 35556405
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactta |
127 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| ||||| || ||| | |||||||||| | ||||||| ||||| |
|
|
| T |
35556486 |
gtcccgtgagcatagcttagttggtaggacaatgcattagtatatgtaggggttggggttcgaaccccggacacccgactta |
35556405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 43875071 - 43874994
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||| ||||| || || ||||||||||| ||||||||||||||||| |
|
|
| T |
43875071 |
tgagcataactcagttgataggacaatgcattattatatgtaggggctgaggttcgaacaccagacaccccacttatt |
43874994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 24074504 - 24074584
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| || || |||||||||||||||||||||||| ||||| || ||| || ||||||||| | |||||| |||||||| |
|
|
| T |
24074504 |
ccgtgatcacagctcagttggtaggacaatgcattattatatgtaggggttgaagttcgaacctcggacacctcacttatt |
24074584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 25139988 - 25139904
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||| |||| |||||||| ||| |||||||||||| |||||||| ||||| |||||||||| | ||| |||||||||| |
|
|
| T |
25139988 |
tgtccagtgaacataattcagttgttagaacaatgcattattatatgcaggggtcggggttcgaaccccgaacatcccacttatt |
25139904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 44136374 - 44136294
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| |||||||| || |||||||||||| |||||||| || ||||| |
|
|
| T |
44136374 |
ccgtgagcataactcagttggtaggacaatatattattatatgcaggggctgaggttcgaaccccagacacctcaattatt |
44136294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 1033060 - 1032978
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||||| |||||||| ||||| ||||||||| | |||||||||||||| |
|
|
| T |
1033060 |
gtcccgtgagtctagctcagttggtgggacaatgcattattatatgcaggggtcggagttcgaacc-cgaacaccccacttatt |
1032978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 1588766 - 1588845
Alignment:
| Q |
51 |
gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| | |||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
1588766 |
gtgagcatagcttagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt |
1588845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 10970261 - 10970344
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||| ||||||||||||| |||||||||| |||||||| || | ||||| |||| | |||||||||||||| |
|
|
| T |
10970261 |
gtcctgtgagcatagctcagttggtaggataatgcattattatatgcaggggctggggttcaaaccccgaacaccccacttatt |
10970344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 50 - 109
Target Start/End: Complemental strand, 26703986 - 26703927
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
26703986 |
cgtgagcataactcagttggtaggacaatgcattattatatgcaagggtcggggttcgaa |
26703927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 38790672 - 38790589
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgagg-ttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||| |||||||| || || || |||||||| ||||||||||||||||| |
|
|
| T |
38790672 |
cccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccgggggttcgaaccccagacaccccacttatt |
38790589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 7540583 - 7540505
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| |||||||| ||||| ||||| |||| |||| |||||||||| |
|
|
| T |
7540583 |
gtgagcataactcacttggtaggacaatgcattattatatgcaggggtcggggttctaaccctggacaacccacttatt |
7540505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 111
Target Start/End: Original strand, 8682375 - 8682441
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | |||| |||||||| ||| | ||||||||| |
|
|
| T |
8682375 |
tgtcccgtgagcatagctcagttggtaggacaattctttattatatgcaggggttggagttcgaacc |
8682441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 75 - 129
Target Start/End: Complemental strand, 13702423 - 13702369
Alignment:
| Q |
75 |
caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||| |||||||| |||||||| |
|
|
| T |
13702423 |
caatgcattattatatgcaggggtcggggttcgaacctcagacacctcacttatt |
13702369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 14012608 - 14012690
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| | |||||||| || || |||||||| | ||||||||||||||| |
|
|
| T |
14012608 |
cccgtgagcatagttcagttggcagggacaatgcattgttatatgcaggggccggggttcgaagtccggacaccccacttatt |
14012690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 29514203 - 29514253
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
29514203 |
ttgtcctgtgagcatagctcagttggtaggacaatgctttattatatgcag |
29514253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 7314754 - 7314811
Alignment:
| Q |
72 |
ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||||| |||||||| || ||||||||||||| | ||||||||||||||| |
|
|
| T |
7314754 |
ggacaatacattattatatgcaggggccgaggttcgaaccccggacaccccacttatt |
7314811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 120
Target Start/End: Complemental strand, 21133618 - 21133545
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacacc |
120 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||||||| |||||||| |||| |||||||||| |||||||| |
|
|
| T |
21133618 |
cccgtgagcataactcagttggcaggaacaatgcattattatatgcaggagtcggggttcgaaccccagacacc |
21133545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 25689548 - 25689503
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatat |
90 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
25689548 |
tgtcccgtgagcatagctcagttggttggacaatgcattattatat |
25689503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 126
Target Start/End: Complemental strand, 26192784 - 26192708
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||||| |||||||||||||||| | | ||||| || |||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcat-attatatgcagaggtcggggttcgaaccccggacaccccactt |
26192708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 27822063 - 27822148
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| |||| |||| ||||||||||||| |||||||||| |||||||| |||| | || ||||| || |||||||||||||| |
|
|
| T |
27822063 |
ttgtcctgtgaacataactcagttggtaggataatgcattattatatgcaggggtccggatttgaaccccaaacaccccacttatt |
27822148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 29937207 - 29937288
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||| | |||||||| || || ||||||||| ||||||||||||||||| |
|
|
| T |
29937207 |
cccgtgagcatagctcagttggtagggacatgtattgttatatgcaggggccggagttcgaacctcagacaccccacttatt |
29937288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 109
Target Start/End: Original strand, 31373313 - 31373378
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||| ||||| || || |||||||||| |
|
|
| T |
31373313 |
ttgtcccgtgagcatagctcagttggtaggacattacattattatatgtaggggcagaggttcgaa |
31373378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 39432426 - 39432345
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||| | | |||||||| ||| | |||||||||| ||||||||||||||||| |
|
|
| T |
39432426 |
cccgtgagcatagctcagttggcagggacatgcaatgttatatgcaggggttggggttcgaacctcagacaccccacttatt |
39432345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 45 - 110
Target Start/End: Complemental strand, 41089251 - 41089186
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||| ||| |||| | |||||||||||||||||||||| |||||||| ||||| |||| |||| |
|
|
| T |
41089251 |
tgtcccgcgagtatagcttagttggtaggacaatgcattattatatgcaggggtcggggtttgaac |
41089186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 42761962 - 42761901
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||| |||||||| || || ||||||||| |
|
|
| T |
42761962 |
ccgtgagcataactcagttggtatgacaatgcattattatatgcagggggcggggttcgaac |
42761901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 128
Target Start/End: Original strand, 4293904 - 4293960
Alignment:
| Q |
72 |
ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||||||| |||||| |||| |||| |
|
|
| T |
4293904 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccagacatcccatttat |
4293960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 129
Target Start/End: Complemental strand, 8740749 - 8740673
Alignment:
| Q |
53 |
gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| |||||||| || ||||||||||| | ||||||| ||||||| |
|
|
| T |
8740749 |
gagcataactcagttggtaggacaatgcagtattatatgcaggggctgaggttcgaactccggacaccctacttatt |
8740673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 9578098 - 9578050
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggt |
98 |
Q |
| |
|
||||||| |||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
9578098 |
cgtgagcttagttcagttggcagaacaatgcattattatatgcagaggt |
9578050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 42762111 - 42762047
Alignment:
| Q |
65 |
gttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||||||||| || | | ||||||||||||||| |
|
|
| T |
42762111 |
gttgataggacaatgcattactatatgcaggggtcgaggttcaaatcccggacaccccacttatt |
42762047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 8034525 - 8034608
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||||| |||||||| | || |||||||||| | |||||||||||||| |
|
|
| T |
8034525 |
gtcccgtgagcataactccgttaataggacaatgcattattatatgcaggagccggggttcgaaccccgaacaccccacttatt |
8034608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 13537383 - 13537328
Alignment:
| Q |
74 |
acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| | |||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
13537383 |
acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttatt |
13537328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 13626931 - 13626876
Alignment:
| Q |
74 |
acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| | |||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
13626931 |
acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttatt |
13626876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Complemental strand, 30942675 - 30942616
Alignment:
| Q |
70 |
taggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
30942675 |
taggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatt |
30942616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 44923401 - 44923314
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcatta-taatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||||| ||| ||| || |||||||||||| | |||||||| ||||| |||||||||| | ||| ||||| ||||| |
|
|
| T |
44923401 |
attgtcccgtcagcatagctcaattgataagacaatgcattatttatatgcaggggtcggggttcgaaccccggactccccatttatt |
44923314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 220461 - 220379
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||| | | ||||||||||||| |||||||| | | ||||||||||||||| |
|
|
| T |
220461 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt |
220379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 689616 - 689534
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||| | | ||||||||||||| |||||||| | | ||||||||||||||| |
|
|
| T |
689616 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt |
689534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 734084 - 734002
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||| | | ||||||||||||| |||||||| | | ||||||||||||||| |
|
|
| T |
734084 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt |
734002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 857980 - 857898
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||| | | ||||||||||||| |||||||| | | ||||||||||||||| |
|
|
| T |
857980 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttatt |
857898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 107
Target Start/End: Original strand, 7603729 - 7603787
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcg |
107 |
Q |
| |
|
||||||||||| | |||| ||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
7603729 |
ccgtgagcataacttagttcgtaggacaatgcattattatatgcagtggtcggggttcg |
7603787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 100
Target Start/End: Complemental strand, 36467984 - 36467930
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcg |
100 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||||||||| |||||||| ||||| |
|
|
| T |
36467984 |
gtcccgtgattatagctcagttggtatgacaatgcattattatatgcaggggtcg |
36467930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 86
Target Start/End: Complemental strand, 44361024 - 44360994
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattata |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44361024 |
catagttcagttggtaggacaatgcattata |
44360994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 3379748 - 3379665
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||||| | |||||||| || | |||||||||| | ||||||||||||||| |
|
|
| T |
3379748 |
ttgtcccgtgagcataactcagttgataggataatgcattgttatatgcag-gggctgggttcgaacc-ccgacaccccacttatt |
3379665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Original strand, 22426422 - 22426479
Alignment:
| Q |
72 |
ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||||| || ||| |||||||||||| | ||||||||| ||||| |
|
|
| T |
22426422 |
ggacaatgcattattatatgtaggggttgaggttcgaacccctgacaccccatttatt |
22426479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 122
Target Start/End: Original strand, 28378806 - 28378883
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc |
122 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||| ||||| |||||||| || |||||||||||| | |||||||| |
|
|
| T |
28378806 |
tgtcccgtgaacatagctcaattggtaggacaagatattattatatgcaggggctgaggttcgaaccccggacacccc |
28378883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 33570503 - 33570446
Alignment:
| Q |
72 |
ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| | ||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
33570503 |
ggacaatgcattgttatatgcatgggtcggggttcgaacctcggacaccccacttatt |
33570446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 35301237 - 35301180
Alignment:
| Q |
72 |
ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| ||||| ||||||||| | ||||||| ||||||| |
|
|
| T |
35301237 |
ggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctacttatt |
35301180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 90
Target Start/End: Complemental strand, 40329306 - 40329261
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatat |
90 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||||||| |||| |
|
|
| T |
40329306 |
tgtcccgtgagcatagctcggttggtagaacaatgcattattatat |
40329261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 5323919 - 5323982
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||| | ||||||| || ||||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
5323919 |
cccgtgagcatact-cagttggcagtgacaatgcattattatatgcaggggtcggggttcgaacc |
5323982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 17110314 - 17110381
Alignment:
| Q |
62 |
tcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||||| ||||| |||| | |||| |||||||||| |
|
|
| T |
17110314 |
tcagttggtagggacaatgcattattatatgcaggggtcggggttcaaacc-cggacatcccacttatt |
17110381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 129
Target Start/End: Complemental strand, 22847331 - 22847279
Alignment:
| Q |
77 |
atgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| | |||||||| |||||||||||||||| || ||||| |||||||| |
|
|
| T |
22847331 |
atgcattgttatatgcaggggtcgaggttcgaaccccacacacctcacttatt |
22847279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 31129301 - 31129380
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||||| |||||||| ||| |||||||||||| ||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
31129301 |
cccgtgatcatagctcagttggcagggacaatgcattattatatgg---ggtcggggttcgaaccccggacaccccacttatt |
31129380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 82
Target Start/End: Original strand, 33566954 - 33566990
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcat |
82 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
33566954 |
gtcccgtgagcatagctcagttgataggacaatgcat |
33566990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 40329689 - 40329621
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtc-gaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| |||| |||||||||| | | ||||||| ||||||| |
|
|
| T |
40329689 |
tcagttggtaggataatgcattattatatgcatgggtcggaggttcgaatctcggacaccctacttatt |
40329621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 100)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 9924849 - 9924934
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||| |||||||||| | ||||| ||||||||| |
|
|
| T |
9924849 |
ttgtcccgtgagcatagttcagttggtaggacaacgcattattatatgcaggggtcggggttcgaaccccggacactccacttatt |
9924934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 47018047 - 47017963
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
47018047 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
47017963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 56546549 - 56546466
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||||| || || |||||||||| ||||||||||||||||| |
|
|
| T |
56546549 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacagacaccccacttatt |
56546466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 32885686 - 32885766
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||| ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
32885686 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttatt |
32885766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 45350270 - 45350354
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||| |||||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
45350270 |
tgtcccgtcagcatagctcagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttatt |
45350354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 45359749 - 45359833
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||| |||||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
45359749 |
tgtcccgtcagcatagctcagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttatt |
45359833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 548987 - 548904
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| || || |||||||| | ||||||||||||||||| |
|
|
| T |
548987 |
gtcccgtgagcatagcccagttggtaggacaatgcattattatatgcaggggccggggttcgaaactcagacaccccacttatt |
548904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 13211452 - 13211369
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||| ||||| |||||||||| | ||||| ||||||||| |
|
|
| T |
13211452 |
gtcccgtgagtatagttcagttggtaggacaatgcattattatatgcatgggtcggggttcgaaccccggacactccacttatt |
13211369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 34773779 - 34773700
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||| | ||||||||||||||| |
|
|
| T |
34773779 |
cgtgagcatagttcagttgataggacaatgcattattatatgcaggggctgaggttcgaaccccggacaccccacttatt |
34773700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 43115263 - 43115346
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |||||||| ||||||| |||||||| | ||||||||| ||||| |
|
|
| T |
43115263 |
gtcccgtgagcttagttcagttggtaggacaatgtattattatatgcaggggtcgagattcgaaccccggacaccccatttatt |
43115346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 129
Target Start/End: Complemental strand, 46735072 - 46734986
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||| | ||| ||||| |||| | ||||||||||||||| |
|
|
| T |
46735072 |
attgtcccgtgagcatagctcagttggtaggacactgcattattatatgcagggatcggggttcaaacctcggacaccccacttatt |
46734986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 46 - 130
Target Start/End: Complemental strand, 9285759 - 9285675
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtc-gaggttcgaaccgcagacaccccacttatta |
130 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||||| |||| | |||||||||| |||||||||||||||||| |
|
|
| T |
9285759 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcag-ggtctggggttcgaaccccagacaccccacttatta |
9285675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 48 - 128
Target Start/End: Original strand, 34106598 - 34106678
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||| |||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
34106598 |
cccgtgagcatagctcagttggcaggaacaatgcattattatatgcagaggtcg-ggttcgaaccccagacaccccacttat |
34106678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 35909262 - 35909198
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
35909262 |
tcccgtgaacatagttcagttggtaggacaatacattattatatgcagaggtcggggttcgaacc |
35909198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 9172473 - 9172406
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
9172473 |
ttgtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaacc |
9172406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 24234174 - 24234091
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| |||||||| || || |||| ||||| | ||||||||||||||| |
|
|
| T |
24234174 |
gtcccgtgagcatagctcagttggtaggtcaatgcattattatatgcaggggccggggtttgaaccccggacaccccacttatt |
24234091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 50657875 - 50657958
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||| |||| ||||||||| || ||| |||||||||| |
|
|
| T |
50657875 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcatggttcgaactccaaacatcccacttatt |
50657958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 48968309 - 48968227
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
48968309 |
cccgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
48968227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 20753227 - 20753142
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| ||||| || || || |||||||||| | |||||| |||||||| |
|
|
| T |
20753227 |
ttgtcccgtgagcatagctcagttggtaggaaaatgcattattatatgtaggggccggggttcgaaccccggacaccacacttatt |
20753142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 8690212 - 8690292
Alignment:
| Q |
50 |
cgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
8690212 |
cgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
8690292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 31601800 - 31601884
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||| ||||| |||||||| || |||| |||||||| | ||||||||||||||| |
|
|
| T |
31601800 |
tgtcccgtgagtatagctcagttggtagaacaatgtattattatatgcaggggccgagattcgaaccccggacaccccacttatt |
31601884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 38433305 - 38433389
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||||||||||| ||||| || |||| ||||||||| ||||||||||||||||| |
|
|
| T |
38433305 |
tgtcctgtgaacatagttcagttgataggacaatgcattattatatgtaggagtcggagttcgaaccccagacaccccacttatt |
38433389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 56314759 - 56314839
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |||||||| |||| |||||||||| | |||||| |||||||| |
|
|
| T |
56314759 |
ccgtgatcatagttcaattggtaggacaatgcattattatatgcaggggtcagggttcgaaccacggacaccacacttatt |
56314839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 3465578 - 3465661
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| |||||||| || || ||||||||| | ||||||||||||||| |
|
|
| T |
3465578 |
gtcccgtaagcataactcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttatt |
3465661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 35031382 - 35031461
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||| | ||||||||||||| |||| | |||| ||||| |
|
|
| T |
35031382 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggagccgaggttcgaaccccagatatcccatttatt |
35031461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 52031202 - 52031285
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||| |||||||| |||| |||||||||| |||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
52031202 |
tcccgtgagcttagctcagttggcaggaacaatgcattagtatatgcaggggtcggggttcgaaccccagacaccccacttatt |
52031285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 3442847 - 3442921
Alignment:
| Q |
55 |
gcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| | || || |||||||||| ||||||||||||||||| |
|
|
| T |
3442847 |
gcatagctcagttggtaggacaatgcattattatatgtcggggccggggttcgaaccccagacaccccacttatt |
3442921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 4722567 - 4722513
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagagg |
97 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4722567 |
attgtcccgtgaacatagctcagttggtaggacaatgcattattatatgcagagg |
4722513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 15640542 - 15640460
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||| || ||||||||||||| |||||||| | ||| |||||||||| ||||||||||||||||| |
|
|
| T |
15640542 |
cccgtgagcatatctcagttggcagagacaatgcattattatatgcagtgttcggggttcgaacctcagacaccccacttatt |
15640460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 28520830 - 28520748
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
28520830 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
28520748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 40150469 - 40150551
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| |||| ||| ||||| |||||||||| | |||||| |||||||| |
|
|
| T |
40150469 |
cccgtgagcatagttcagttggcaggaacaatgcattattatatacaggggtcggggttcgaaccccggacacctcacttatt |
40150551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 42411553 - 42411471
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||| || |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
42411553 |
cccgtgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
42411471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 52560760 - 52560842
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |||||||| || || |||||||||| || |||| |||||||| |
|
|
| T |
52560760 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacatacacttcacttatt |
52560842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 53698075 - 53697997
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||| ||||||| |||||||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
53698075 |
gtgaacatagctcagttgttaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
53697997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 35747576 - 35747499
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||| ||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
35747576 |
tgagcatagctcaattggtaggacaatgtattattttatgcaggggtcgaggttcgaactccggacaccccacttatt |
35747499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 3544529 - 3544449
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| ||||||| ||| || |||||||||| | ||| ||| ||||||| |
|
|
| T |
3544529 |
ccgtgaacatagctcagttggtaggacaatgcattattatatgcaaaggccggggttcgaaccccggactccctacttatt |
3544449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 46 - 126
Target Start/End: Complemental strand, 5430465 - 5430385
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |||||||| | | |||||||||| | |||||||||||| |
|
|
| T |
5430465 |
gtcccgtgagcatagctcagttggtaggacaatgtattattatatgcagggaccagggttcgaaccccggacaccccactt |
5430385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 12856182 - 12856262
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||| ||||| || ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
12856182 |
ccgtgagcatagctcagttggtaggataatgcactattatatgaaggggtcggagttcgaaccccggacaccccacttatt |
12856262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21476181 - 21476098
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||||||| ||||| | |||||||| |||||||| |||||| |||||||| | |||| |||||||||| |
|
|
| T |
21476181 |
gtcccgtgagcatagctcagttgataggatattgcattattatatgcaggggtcgatgttcgaactccggacatcccacttatt |
21476098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 37728939 - 37728998
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
37728939 |
gtgagcatagttcagttggtagggatatgcattattatatgcaggggtcgaggttcgaac |
37728998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 9692958 - 9693040
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| | |||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
9692958 |
cccgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
9693040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 10098125 - 10098203
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||| |||| ||||||||||||||||||| |||||||| || || | |||||||| | ||||||||||||||| |
|
|
| T |
10098125 |
gtgaacatagctcagctggtaggacaatgcattattatatgcaggggccgggattcgaaccccggacaccccacttatt |
10098203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 14149789 - 14149871
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
14149789 |
cccgtgaccatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
14149871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 44 - 130
Target Start/End: Original strand, 20181204 - 20181290
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta |
130 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| ||| ||||| || ||| | |||||||| | |||||||| || |||||| |
|
|
| T |
20181204 |
ttgttccgtgagcatagctcagttggtaggacaatgcagtattatatgtaggggtaggggttcgaatctcagacacctcatttatta |
20181290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 26253948 - 26254030
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||| ||||| |||||||| ||||| ||||||| | | ||||| ||||||||| |
|
|
| T |
26253948 |
tcccatgagcatagttcagttggtagaacaatgtattattatatgcaggggtcggagttcgaatcccggacactccacttatt |
26254030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 27921892 - 27921974
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |||||||| || || |||||||||| |||||| | |||||||| |
|
|
| T |
27921892 |
tcccgtgagcatagctcagttggtagggacatgcattattatatgcaggggccggggttcgaaccccagacatctcacttatt |
27921974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 34684564 - 34684646
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||| |||||||| ||| |||||| |||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
34684564 |
tcccgtgagcataattcaattggtaggggaatacattattatatgcagaggttggaattcgaacctcagacaccccacttatt |
34684646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 46799404 - 46799485
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||||| ||||||||| | ||||||||||||| | ||||||||| ||||| |
|
|
| T |
46799404 |
cccgtgagcatagtttagttggcaggcacaatgcattattatatgcaga-gccgaggttcgaaccccggacaccccatttatt |
46799485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 53815692 - 53815774
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || | |||||||||| | ||||||||||||||| |
|
|
| T |
53815692 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttatt |
53815774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 109
Target Start/End: Complemental strand, 55266534 - 55266472
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
55266534 |
tcccgtgagcatagctcagttggtagaacaatgcattattatatgcaggggtcggagttcgaa |
55266472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 53 - 122
Target Start/End: Original strand, 5635191 - 5635260
Alignment:
| Q |
53 |
gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc |
122 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||| |||||||| ||||| ||||| |||| | |||||||| |
|
|
| T |
5635191 |
gagcatagctcagttgctaggacaatgcattattatatgcaggggtcggggttcaaaccccggacacccc |
5635260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 111
Target Start/End: Complemental strand, 33944463 - 33944398
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||| |||||||| || || |||||||||| |
|
|
| T |
33944463 |
gtcccgtgagcataactcagttggtaggataatgcattattatatgcaggggccggggttcgaacc |
33944398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 44074847 - 44074931
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||||||| |||||||| | | || ||||||| | | ||||||||||||||| |
|
|
| T |
44074847 |
ttgtcccgcgagcatagctcagt-ggtaggacaatgcattattatatgcagggattgaagttcgaatcccggacaccccacttatt |
44074931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 46482918 - 46482869
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||| |||||||| |
|
|
| T |
46482918 |
tgtcccgtgagcataattcagttggtaggacaatacattattatatgcag |
46482869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 94
Target Start/End: Complemental strand, 50783535 - 50783486
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
50783535 |
tgtcccgtgagcatagctcagttggtaggacattgcattattatatgcag |
50783486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 22751003 - 22751087
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||||| |||| |||||||| ||||| ||||| |||| | |||||||| ||||| |
|
|
| T |
22751003 |
tgtcccgtgagcatagctcagttcgtaggtcaatgcgttattatatgcaggggtcggggttcaaaccccgaacaccccatttatt |
22751087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 29269415 - 29269332
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||| ||||| || || | | |||||||| | ||||||||||||||| |
|
|
| T |
29269415 |
tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgtaggggctgggattcgaaccccggacaccccacttatt |
29269332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 36954131 - 36954215
Alignment:
| Q |
47 |
tcccgtgagcatagttca-gttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||| ||||| ||| |||||||||||| |||||||| ||||| |||||||||| | ||||||||| ||||| |
|
|
| T |
36954131 |
tcccgtgagcatagctcaagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttatt |
36954215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 95
Target Start/End: Original strand, 46937262 - 46937306
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcaga |
95 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
46937262 |
gtgagcatagctcagttggtaggacaatgcattataatatacaga |
46937306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 52743222 - 52743270
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| ||||||| |
|
|
| T |
52743222 |
tgtcccgtgagcatagctcggttggtaggacaatgcattattatatgca |
52743270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 122
Target Start/End: Complemental strand, 534864 - 534789
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccc |
122 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||| || |||||||| ||||| |||| ||| | | |||||||| |
|
|
| T |
534864 |
tcccgtgagcatagctcaattggtaggacaatgcatcattatatgcaggggtcggggtttgaatcccggacacccc |
534789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 6481672 - 6481601
Alignment:
| Q |
58 |
tagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||| |||||| || ||||||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
6481672 |
tagttcagttggcagggacatgcatgattatatgcagaggccgaggttcgaacctcagacgccccacttatt |
6481601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 85
Target Start/End: Original strand, 17859769 - 17859812
Alignment:
| Q |
42 |
cattgtcccgtgagcatagttcagttggtaggacaatgcattat |
85 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
17859769 |
cattgtcctgtgagcatagctcagttggtaggacaatgcattat |
17859812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 23661458 - 23661375
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||| | ||||| || ||| | |||||||||| | |||||||||||||| |
|
|
| T |
23661458 |
gtcccgtgaacatagctcagttgctaggacaatgcattgttatatgtaggggtaggggttcgaaccccgaacaccccacttatt |
23661375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 49089377 - 49089294
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||| | ||||||||||||||| |||||| |||||||| || ||| ||||||||| | |||| ||||||||| |
|
|
| T |
49089377 |
gtcccgtgagcttagcttagttggtaggacaatacattattatatgcaggggccgaagttcgaacccctgacattccacttatt |
49089294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 51077878 - 51077945
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| ||||||| | | |||||||||||||| |
|
|
| T |
51077878 |
tcagttggtaggacaatgcattattatatgcaggggtcggagttcgaatctcgaacaccccacttatt |
51077945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 56 - 110
Target Start/End: Original strand, 6053985 - 6054039
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| || || ||||||||| |
|
|
| T |
6053985 |
catagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaac |
6054039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 52 - 129
Target Start/End: Original strand, 9084759 - 9084837
Alignment:
| Q |
52 |
tgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||| | |||||||| ||||| | |||||||| | ||||||||||||||| |
|
|
| T |
9084759 |
tgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttatt |
9084837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 12820504 - 12820422
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| || ||||||||||| | |||||||| ||||| |||| ||||| ||||||||||||||| |
|
|
| T |
12820504 |
cccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttatt |
12820422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 33076528 - 33076608
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||| |||||||| ||||| |||||||||| | ||||||| ||||||| |
|
|
| T |
33076528 |
tcccgtgagcatagctcagttgg-gggac-atgcattattatatgcaggggtcggggttcgaaccccggacaccctacttatt |
33076608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 36008271 - 36008353
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||| | |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
36008271 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttatt |
36008353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 71 - 129
Target Start/End: Complemental strand, 37032254 - 37032196
Alignment:
| Q |
71 |
aggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||| ||||| | |||||||| | ||||||||||||||| |
|
|
| T |
37032254 |
aggacaatgcattattatatgcaggggtcgggattcgaaccccggacaccccacttatt |
37032196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 128
Target Start/End: Complemental strand, 43606200 - 43606118
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||| |||||||| | ||| |||| || | ||||||||||| |||| |
|
|
| T |
43606200 |
gtcccgtgaacatagctcagttgataggacaatgcattattatatgcagggatcggggtttaaatcccagacaccccatttat |
43606118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 43 - 109
Target Start/End: Original strand, 55345756 - 55345822
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |||| |||| ||| ||| |||||||||| |
|
|
| T |
55345756 |
attgtcctttgagcatagctcagttggtaggacaatgcgttattatatacaggggttgaggttcgaa |
55345822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 144
Target Start/End: Original strand, 2565257 - 2565353
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttattagccactaggctacc |
144 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||| | |||||||| ||||| ||||||| | | |||||||||||||| |||||||||||||| |
|
|
| T |
2565257 |
cccgtgagcatagctcagttgacagggacaatgcattgttatatgcaggggtcggagttcgaatcccgaacaccccacttatt-gccactaggctacc |
2565353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 129
Target Start/End: Complemental strand, 6637823 - 6637739
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||| ||||| |||| ||||| |||||| |||||||| ||| | |||||||||| | |||||||||||||| |
|
|
| T |
6637823 |
ttgtcccgtgagcatagc-cagttcgtagaacaatacattattatatgcaggggttggggttcgaaccccgaacaccccacttatt |
6637739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 20166313 - 20166394
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||| |||||||| ||| ||||||| | |||||||| || ||||||||||||| |||| |||||||||||| |
|
|
| T |
20166313 |
cccgtgagcgtagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccccagataccccacttatt |
20166394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 93
Target Start/End: Complemental strand, 52608661 - 52608620
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
52608661 |
tgagcatagctcagttggtaggacaatgcattattatatgca |
52608620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 109
Target Start/End: Complemental strand, 6710312 - 6710248
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||| ||||||||| | ||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
6710312 |
tgtcccatgagcatagcttagttggttggacaatgcattattatatgcaagagtcgaggttcgaa |
6710248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 20266857 - 20266905
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
20266857 |
gtcccgtgagcttagctcatttggtaggacaatgcattattatatgcag |
20266905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 35803190 - 35803110
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||||||||| |||||||| | ||| |||||||| ||||||||||||||| |
|
|
| T |
35803190 |
ccgtaagcatagctcaattggtaggacaatgcattattatatgcagggaccgaagttcgaactctcgacaccccacttatt |
35803110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 93
Target Start/End: Complemental strand, 40200857 - 40200809
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
40200857 |
tgtcccgtgaacattgctcagttggtaggacaatgcattattatatgca |
40200809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 44374175 - 44374131
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggac-aatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44374175 |
gtgagcatagttcagttggtaggacaaatgcattattatatgcag |
44374131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 49319392 - 49319471
Alignment:
| Q |
50 |
cgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||| | ||||| |||||||| |||||||| ||||| ||||| |||| | ||||||||||||||| |
|
|
| T |
49319392 |
cgtgagcatagctcagttggcatggaca-tgcattattatatgcaggggtcggggttccaaccccggacaccccacttatt |
49319471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 53291436 - 53291484
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||| ||||||| |
|
|
| T |
53291436 |
tgtcccgtgagcataactcagttggtaggataatgcattattatatgca |
53291484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 101
Target Start/End: Original strand, 6365323 - 6365374
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcga |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
6365323 |
cgtgagcataacccagttggtaggacaatgcattattatatgcaggggtcga |
6365374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 26203883 - 26203804
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||| |||| || ||| | |||| ||||| | |||| |||||||||| |
|
|
| T |
26203883 |
cgtgagcatagctcagttggtaggacagtgcattattatataaaggggttggggtttgaacccctgacatcccacttatt |
26203804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 47416479 - 47416546
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||| ||| | |||||||| | | ||||||||||||||| |
|
|
| T |
47416479 |
tcagttggtaggataatggattattatatgcaggggttggggttcgaatctcggacaccccacttatt |
47416546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 31578014 - 31578060
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgc |
92 |
Q |
| |
|
||||||||| ||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
31578014 |
gtcccgtgaacatagctgagttggtaggacaatgcattattatatgc |
31578060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 128
Target Start/End: Complemental strand, 56531332 - 56531254
Alignment:
| Q |
51 |
gtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||| | |||||||| || || ||||||||| | |||||||||||||| |
|
|
| T |
56531332 |
gtgagcatagctcagttggcaaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccccacttat |
56531254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 438479 - 438430
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggac-aatgcattataatatgcag |
94 |
Q |
| |
|
||||||||||||||| ||||||||||| || |||||||||| |||||||| |
|
|
| T |
438479 |
gtcccgtgagcatagctcagttggtagaacaaatgcattattatatgcag |
438430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 80 - 129
Target Start/End: Complemental strand, 7768854 - 7768805
Alignment:
| Q |
80 |
cattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||||||| || |||||||||| | ||||||||||||||| |
|
|
| T |
7768854 |
cattattatatgcagaggccggggttcgaaccccggacaccccacttatt |
7768805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 52 - 109
Target Start/End: Original strand, 33536226 - 33536283
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||| |||| || |||||||||||||| |
|
|
| T |
33536226 |
tgagcatagctaagttggtaagacaatgcattattttatgtaggggtcgaggttcgaa |
33536283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 41492596 - 41492516
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||| |||||||| || || |||||||||| ||||||||||||||| |
|
|
| T |
41492596 |
cccgtgagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaacc-tggacaccccacttatt |
41492516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 49743359 - 49743440
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||| |||||||| || || | |||||||| | |||||| |||||||| |
|
|
| T |
49743359 |
cccgcgagcatagttcagttggcagggatatgcattattatatgcaggggccgggattcgaaccccggacacctcacttatt |
49743440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 12868126 - 12868078
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||| |||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
12868126 |
gtcccttgagcataacttagttggtaggacaatgcattattatatgcag |
12868078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 26708636 - 26708569
Alignment:
| Q |
62 |
tcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||| | |||||||||| |||||||| ||| |||| |
|
|
| T |
26708636 |
tcagttggtagggacaatgcattattatatgcaggggttg-ggttcgaacctcagacacctcacctatt |
26708569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 129
Target Start/End: Complemental strand, 35230388 - 35230312
Alignment:
| Q |
53 |
gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
35230388 |
gagcatagctcagttggtagggatatgcattgctatatgcatgggtcggggttcgaacctcggacaccccacttatt |
35230312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 44272935 - 44273014
Alignment:
| Q |
50 |
cgtgagcatagttcagttggta-ggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| ||||||| |||||||| ||||| |||||||| |||||||| ||||| ||||||||| | || |||||||||||| |
|
|
| T |
44272935 |
cgtgaacatagtttagttggtatggaca-tgcattattatatgcaggggtcggagttcgaacctcggataccccacttatt |
44273014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 55656208 - 55656160
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| |||||| |||||||| |
|
|
| T |
55656208 |
gtcccgtgagcataactcagttggttggacaatacattattatatgcag |
55656160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 74)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 33800888 - 33800971
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| ||||||||||||||||| |
|
|
| T |
33800888 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt |
33800971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 18872517 - 18872599
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| | |||||||||||||| |
|
|
| T |
18872517 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttatt |
18872599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 19059105 - 19059021
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| || || |||||||||| ||||||||||||||| |
|
|
| T |
19059105 |
tgtcccgtgagcatagctcagttggtaggacaatgcattatcatatgcaggggccggggttcgaaccctggacaccccacttatt |
19059021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 1244828 - 1244744
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| ||||||| |||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
1244828 |
tgtcctgtgagcatagcacagttggtaggacaaagcattattatatgcaggggtcagggttcgaaccccagacaccccacttatt |
1244744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 27440392 - 27440333
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
27440392 |
tgagcatagctcagttggtaggacaatgcattattatatgcagtggtcgaggttcgaacc |
27440333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 29106138 - 29106055
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||| ||| |||||||||||||||||||| |||||||| || ||| ||||||||| |||||||||||||||| |
|
|
| T |
29106138 |
gtcctgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaagttcgaaccctagacaccccacttatt |
29106055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 29841347 - 29841426
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| || |||| |||||||| | ||||||||||||||| |
|
|
| T |
29841347 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaagggccgagattcgaaccccggacaccccacttatt |
29841426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 843469 - 843385
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| ||||| || || || |||||||||| | ||||||||||||||| |
|
|
| T |
843469 |
tgtcccgtgagcatatctcagttggtatgacaatgcattattatatgtaggggacggggttcgaaccccggacaccccacttatt |
843385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 32158515 - 32158431
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||| |||||||| || || |||||||||| | |||||||||||||| |
|
|
| T |
32158515 |
tgtcccgtgagcttagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatt |
32158431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 33729772 - 33729856
Alignment:
| Q |
46 |
gtcccgtgagcat-agttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |||||||| || || |||||||| | ||||||||||||||||| |
|
|
| T |
33729772 |
gtcccgtgagcattaactcagttggtaggacaatgcattattatatgcaggggccggggttcgaatctcagacaccccacttatt |
33729856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 129
Target Start/End: Complemental strand, 2411386 - 2411311
Alignment:
| Q |
54 |
agcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |||||||| || || ||||||||| ||||||||||||||||| |
|
|
| T |
2411386 |
agcatagctcagttggtaggacaatgtattattatatgcaggggccggagttcgaaccccagacaccccacttatt |
2411311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 18478002 - 18478081
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||| | || || |||||||||| ||||||||||||||| |
|
|
| T |
18478002 |
cgtgagcatagctcagttggtaggacaatgcattattatatgctggggccggggttcgaaccctggacaccccacttatt |
18478081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 42 - 129
Target Start/End: Complemental strand, 20945995 - 20945908
Alignment:
| Q |
42 |
cattgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |||||||| || || |||||||| | ||||||||||||||| |
|
|
| T |
20945995 |
cattgtcccgtgagcataactcaattggtaggacaatgcattattatatgcaggggccggggttcgaaatccggacaccccacttatt |
20945908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 22600035 - 22599953
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| ||| | | || ||||| ||||||||||||||||| |
|
|
| T |
22600035 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcag-ggttgggatttgaaccccagacaccccacttatt |
22599953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 24205435 - 24205513
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | ||||| || |||| ||||||||||| | ||||||||||||||| |
|
|
| T |
24205435 |
cgtgaacatagttcagttggtaggacaatgcattgttatatgtaggggtc-aggttcgaaccccggacaccccacttatt |
24205513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 40339201 - 40339134
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |||||||| || || |||||||||| |
|
|
| T |
40339201 |
ttgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaacc |
40339134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 29096403 - 29096325
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||| || || ||||||||| | ||||||||||||||| |
|
|
| T |
29096403 |
gtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggagttcgaaccccggacaccccacttatt |
29096325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 129
Target Start/End: Complemental strand, 4674912 - 4674832
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
4674912 |
cgtgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
4674832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 1463870 - 1463949
Alignment:
| Q |
51 |
gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
1463870 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
1463949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 2029228 - 2029145
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| ||||| |||||||| ||||| | |||||||| | |||||||||||||| |
|
|
| T |
2029228 |
gtcccgtgagcataacttagttggtaggacaatgtattattatatgcaggggtcgggattcgaaccccgaacaccccacttatt |
2029145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 109
Target Start/End: Complemental strand, 4666546 - 4666483
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
4666546 |
gtcccgtgagcatagctcaattggtagaacaatgcattattatatgcaagggtcgaggttcgaa |
4666483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 6447580 - 6447497
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
6447580 |
tcccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt |
6447497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 6614138 - 6614055
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||| ||||||| |||| |||||| |||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
6614138 |
gtcccgcgagcataactcagctggtagaacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttatt |
6614055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 7234956 - 7234889
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| |||||||||||||||||| ||||| |||||||| |||||||||| |||| |||||| ||||| |
|
|
| T |
7234956 |
tcagtcggtaggacaatgcattattatatgtagaggtcggggttcgaaccccagataccccatttatt |
7234889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 47 - 98
Target Start/End: Complemental strand, 7645201 - 7645150
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggt |
98 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| |||||||||||| |
|
|
| T |
7645201 |
tcccgtgagcatagcttagttggtaggacaatgcattattatatgcagaggt |
7645150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 8015830 - 8015913
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||||| | |||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
8015830 |
gtcccgtgagcatatctcagtcggtaggataatgcattattacatgcaggggccggggttcgaaccccggacaccccacttatt |
8015913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 27219663 - 27219580
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| ||||||| || || ||||| |||| | |||||||||||||| |
|
|
| T |
27219663 |
gtcccgtgagcatagcttagttggtaggacaatgcattattatatgcatgggccggggttcaaaccccgtacaccccacttatt |
27219580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 29144153 - 29144220
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| |||| |||| ||||||||||| ||||| |
|
|
| T |
29144153 |
tcagttggtaggacaatgcattattatatgcaggggtcggggtttgaactccagacaccccatttatt |
29144220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 29266063 - 29266146
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||| |||||||| |||| |||||||| |||||||| |||||||| |
|
|
| T |
29266063 |
gtcccgtgagcatagctcaattgataggacaatgcattattatatgcaggggtcagagttcgaacatcagacaccacacttatt |
29266146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 36045234 - 36045151
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagga-caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| ||||||| | || ||||||||||| |||||||| ||||| |||||||||| | ||||||||||||||| |
|
|
| T |
36045234 |
tcccgtgagcatagctcagttgacaagaacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
36045151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 37303930 - 37304012
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||| ||||| |||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
37303930 |
cccgtgagcatagctcagttggcagggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccacttatt |
37304012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 123
Target Start/End: Original strand, 29050795 - 29050872
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacacccca |
123 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| |||||||| || || |||| |||| | ||||||||| |
|
|
| T |
29050795 |
gtcccgcgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggtttgaactccggacacccca |
29050872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 10508574 - 10508658
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| ||||| |||||||| || | |||||||| | ||||||||||||||| |
|
|
| T |
10508574 |
tgtcccgtgaacatagctcagttggtaggacaatgtattattatatgcaggggccacggttcgaaacctggacaccccacttatt |
10508658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 13754000 - 13754084
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||| |||||| |||||||| |||||| |||||||| | ||||||||| ||||| |
|
|
| T |
13754000 |
tgtcccgtaaacataactcagttggtaggacaatacattattatatgcaggggtcgatgttcgaacgtcggacaccccatttatt |
13754084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 14487559 - 14487639
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||| ||||| || ||| | |||||||||| | || | |||||||||| |
|
|
| T |
14487559 |
ccgtgaggataattcagttggtaggacaatgcattattatatgtaggggttggggttcgaacctcggatatcccacttatt |
14487639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 26302590 - 26302511
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |||| ||| || || ||||||||| | ||||||||||||||| |
|
|
| T |
26302590 |
ccgtgagcatagctcggttggtaggacaatgcattattatatacag-ggccggagttcgaacctcggacaccccacttatt |
26302511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 31934972 - 31934912
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
31934972 |
ccgtgaacataactcagttggtaggacaatgcattattatatgcagagattgaggttcgaa |
31934912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 36888193 - 36888145
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
36888193 |
gtcccgtgagcatatctcagttggtaggacaatgcattattatatgcag |
36888145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 129
Target Start/End: Complemental strand, 42455483 - 42455411
Alignment:
| Q |
57 |
atagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||| || || ||||||||| | ||||| ||||||||| |
|
|
| T |
42455483 |
atagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacactccacttatt |
42455411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 42595735 - 42595819
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| |||||| |||||||| | || |||| ||||| | |||||||||||||| |
|
|
| T |
42595735 |
tgtcccgtgagcatagctcaattggtaggacaatacattattatatgcagggaccggggtttgaaccccgaacaccccacttatt |
42595819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 111
Target Start/End: Original strand, 9577295 - 9577362
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| ||||||| || || |||||||||| |
|
|
| T |
9577295 |
ttgtcccgtgagtataactcagttggtaggacaatgcattattatatgcatgggccggggttcgaacc |
9577362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 21017706 - 21017623
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| ||||| || || | |||| ||||| | |||| |||||||||| |
|
|
| T |
21017706 |
gtcccgtgaacatagctcagttggtaggacaatgcattattatatgtagtggctggggtttgaaccccggacatcccacttatt |
21017623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 23925542 - 23925621
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| |||||||| |||| |||||||| | | || |||||||||||| |
|
|
| T |
23925542 |
cgtgagcataactcagttgataggacaatgcattattatatgcaggggtctgggttcgaatcccggataccccacttatt |
23925621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 64 - 130
Target Start/End: Complemental strand, 973058 - 972992
Alignment:
| Q |
64 |
agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatta |
130 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| || || |||||||||| | ||| |||||||||||| |
|
|
| T |
973058 |
agttggtaggacaatgcattattatatacaggggccggggttcgaaccccggaccccccacttatta |
972992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 6806739 - 6806657
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtag-gacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| || ||||||||||| | |||||||| ||||| | |||||||| | ||||| ||||||||| |
|
|
| T |
6806739 |
cccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcgggattcgaaccccggacactccacttatt |
6806657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 7147117 - 7147036
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggt-aggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||||| ||||| ||||||||| |||||||| ||||| |||||||||| | |||||| || ||||| |
|
|
| T |
7147117 |
cccgtgagcatagctcagttggtaaggac-atgcattattatatgcaggggtcggggttcgaacctctgacacctcatttatt |
7147036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 100
Target Start/End: Original strand, 4793965 - 4794018
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcg |
100 |
Q |
| |
|
||||||||||||| ||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
4793965 |
cccgtgagcatagctcaattggtagggacaatgcattataatatgcaggggtcg |
4794018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 22863770 - 22863811
Alignment:
| Q |
52 |
tgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22863770 |
tgagcacagttcagttggtaggacaatgcattattatatgca |
22863811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 23648328 - 23648388
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
23648328 |
ccgtgagcatagg-cagttggtaggacaatgcattattatatgcagaaattgaggttcgaac |
23648388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 23810244 - 23810184
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaac |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
23810244 |
ccgtgagcatagg-cagttggtaggacaatgcattattatatgcagaaattgaggttcgaac |
23810184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 25660909 - 25660990
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||| | |||||||| || || | |||||||| ||||||||||||||||| |
|
|
| T |
25660909 |
cccgtgagcatagctcagttggcagggatatgcattgttatatgcaggggccgggattcgaaccccagacaccccacttatt |
25660990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 34010534 - 34010595
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||| || ||||| ||||||||| |
|
|
| T |
34010534 |
cgtgaacatagttcagttggtaggacaatgcattattatatataggggtcggagttcgaacc |
34010595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 9176886 - 9176838
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
9176886 |
gtcccgtgagcataactcagttggaaggacaatgcattattatatgcag |
9176838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 20699526 - 20699443
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||||||||||||| |||||| | || || ||||||| | | ||||||||||||||| |
|
|
| T |
20699526 |
tgtctcgtgaccatagctcagttggtaggacaatgcattattatatgc-ggggctgaagttcgaaactcggacaccccacttatt |
20699443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 129
Target Start/End: Complemental strand, 27025534 - 27025446
Alignment:
| Q |
42 |
cattgtcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||||||| ||| |||| || |||||||||| | |||| ||| || | |||||||||| ||||||||||||||||| |
|
|
| T |
27025534 |
cattgtcccgtgagcatagctcatttggccgggacaatgcattgttatattcaggggcctgggttcgaaccccagacaccccacttatt |
27025446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 128
Target Start/End: Complemental strand, 37684576 - 37684536
Alignment:
| Q |
88 |
tatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37684576 |
tatgcagaggtcgaggttcgaactccagacaccccacttat |
37684536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 43404377 - 43404425
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
43404377 |
gtcccttgagcatagctcagttggtaggacaatgcattattgtatgcag |
43404425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 48 - 126
Target Start/End: Original strand, 4067982 - 4068060
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccactt |
126 |
Q |
| |
|
||||||||| ||| |||||||||||| ||||||||| || ||||||| || ||||||||||||| | |||||||||||| |
|
|
| T |
4067982 |
cccgtgagcttagctcagttggtagggacaatgcat-attttatgcagggggcgaggttcgaaccccggacaccccactt |
4068060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 29329018 - 29329065
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
||||||||||||||| |||||||||| || |||||||||| ||||||| |
|
|
| T |
29329018 |
gtcccgtgagcatagctcagttggtaagataatgcattatcatatgca |
29329065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 30403749 - 30403828
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||| |||| ||| || || ||| ||||| | ||||||||||||||| |
|
|
| T |
30403749 |
cgtgagcataactcagttggtaggacaatacattattatatacaggggccggagtttgaaccccggacaccccacttatt |
30403828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 129
Target Start/End: Complemental strand, 42618513 - 42618430
Alignment:
| Q |
47 |
tcccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||| ||| ||||| |||||||| | | || |||||||||||| |
|
|
| T |
42618513 |
tcccgtgagcatacctcagttggcagggacaatgcattattatatacaggggtcggggttcgaatcccggataccccacttatt |
42618430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 129
Target Start/End: Original strand, 10943740 - 10943794
Alignment:
| Q |
75 |
caatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| |||||||| || || |||||||||| | ||||||||||||||| |
|
|
| T |
10943740 |
caatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
10943794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 20735274 - 20735192
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||| ||||| |||||||| ||| |||||||||||| ||||| || || || |||||||| | | ||||||||||||||| |
|
|
| T |
20735274 |
cccgtgaacatagctcagttggcagggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccacttatt |
20735192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 93
Target Start/End: Complemental strand, 42070654 - 42070604
Alignment:
| Q |
43 |
attgtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
||||||| || ||||||| ||||||||||| |||||||||||| ||||||| |
|
|
| T |
42070654 |
attgtcctgtaagcatagctcagttggtagaacaatgcattattatatgca |
42070604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 3536034 - 3535953
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| | |||| ||| | || |||||||||| | ||||||||||||||| |
|
|
| T |
3536034 |
cccgtgagcatagttcagttggcagggacatgcattgttatatacaggagccggggttcgaaccccggacaccccacttatt |
3535953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 129
Target Start/End: Complemental strand, 15978759 - 15978694
Alignment:
| Q |
64 |
agttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| ||||| ||||| || || |||||| ||||| || |||||||||||||| |
|
|
| T |
15978759 |
agttggtaggacaatgtattattatatgtaggggatgaggtttgaaccccaaacaccccacttatt |
15978694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 129
Target Start/End: Original strand, 20186864 - 20186942
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| | |||||||| ||| ||||||||| |||||||| ||||| |||| |||| ||||||||||||||||| |
|
|
| T |
20186864 |
ccgtgagcattgctcagttggcagggacatgcattattatatgcaggggtcggggtt--aaccccagacaccccacttatt |
20186942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 24653136 - 24653220
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||||| |||||||| | ||| ||||||||| |||||||| ||| | |||||||| ||||||| ||||||||| |
|
|
| T |
24653136 |
ttgtcccgtgagcataactcagttggcaagac-atgcattattatatgcaggggttggggttcgaatttcagacactccacttatt |
24653220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 26169096 - 26169047
Alignment:
| Q |
62 |
tcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| | ||||||||| |
|
|
| T |
26169096 |
tcagttggtaggacaatgcattattatatgcaggggttggagttcgaacc |
26169047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 96
Target Start/End: Original strand, 30394569 - 30394614
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagag |
96 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| || ||||||| |
|
|
| T |
30394569 |
gtgagcttagctcagttggtaggacaatgcattattatttgcagag |
30394614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 70 - 111
Target Start/End: Complemental strand, 33141865 - 33141824
Alignment:
| Q |
70 |
taggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
33141865 |
taggacaatgcattattatatgcaggagtcgaggttcgaacc |
33141824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 129
Target Start/End: Complemental strand, 11246591 - 11246511
Alignment:
| Q |
49 |
ccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||| | |||||||| ||||| || || |||| |||||| |||||||||| |
|
|
| T |
11246591 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggctcaaaccccagacatcccacttatt |
11246511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 129
Target Start/End: Complemental strand, 29630046 - 29629962
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||| |||||| | | ||| |||||||||||||||| ||||| || ||| ||| |||||||| |||||| |||||||| |
|
|
| T |
29630046 |
tgtcccgtgggcatagcttaattgataggacaatgcattatcatatgtaggggttgagattcgaaccctggacacctcacttatt |
29629962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 128
Target Start/End: Complemental strand, 37553955 - 37553915
Alignment:
| Q |
88 |
tatgcagaggtcgaggttcgaaccgcagacaccccacttat |
128 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
37553955 |
tatgcagaggccgaggttcgaactccagacaccccacttat |
37553915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1086 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: scaffold1086
Description:
Target: scaffold1086; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 2483 - 2566
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||| || ||| ||||| | ||||||||||||||| |
|
|
| T |
2483 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttatt |
2566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 50 - 129
Target Start/End: Original strand, 4322 - 4401
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||| |||||||| ||||| |||||||||| | ||||| ||||||||| |
|
|
| T |
4322 |
cgtgagcatagctcagttgataggacaatacattattatatgcaggggtcggggttcgaaccccggacactccacttatt |
4401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 101826 - 101909
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||| |||||||| || || |||||||||| || ||| |||||||||| |
|
|
| T |
101826 |
gtcccgtgagcatagctcagctggtaggataatgcattattatatgcaggggccggggttcgaaccccaaacatcccacttatt |
101909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0765 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0765
Description:
Target: scaffold0765; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 129
Target Start/End: Original strand, 738 - 822
Alignment:
| Q |
45 |
tgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||| |||||| |||| ||||||||||| ||||||||||||||| |
|
|
| T |
738 |
tgtcctgtaagcatagttcagttgataggacaatgcattattatatgcggaggctgaggttcgaactctggacaccccacttatt |
822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 129
Target Start/End: Original strand, 16849 - 16924
Alignment:
| Q |
53 |
gagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| ||||| |||||||||| | |||||| ||||||| |
|
|
| T |
16849 |
gagcatagctcagttggtaggacaatgcattattatatgcaggggtcg-ggttcgaaccccgaacaccctacttatt |
16924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 185612 - 185529
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| |||||| |||||||| || ||||||| ||||| || ||| |||||||||| |
|
|
| T |
185612 |
gtcctgtgagcatagctcagttggtaggacaaaacattattatatgcaggggccgaggtttgaaccccaaacatcccacttatt |
185529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1990 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1990
Description:
Target: scaffold1990; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 894 - 972
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| | ||| |||||||||||||||||||| |||||||| || | |||||||| | ||||||||||||||||| |
|
|
| T |
894 |
gtgagcatcgctcacttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttatt |
972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 7072 - 7154
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||| |||||||| || || |||||||||| | ||||||||| ||||| |
|
|
| T |
7072 |
cccgtgagcatagctcagttgttagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccatttatt |
7154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 47412 - 47334
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||| | ||| |||||||||||||||||||| |||||||| || | |||||||| | ||||||||||||||||| |
|
|
| T |
47412 |
gtgagcatcgctcacttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttatt |
47334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 25022 - 25104
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || | |||||||||| | ||||||||||||||| |
|
|
| T |
25022 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttatt |
25104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 44 - 129
Target Start/End: Original strand, 5297 - 5381
Alignment:
| Q |
44 |
ttgtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||| || |||||||| ||| |||||||||||||||||||| |||||||| || || ||||||||| | ||||||||||||||| |
|
|
| T |
5297 |
ttgtcgcgcgagcatagctcaattggtaggacaatgcattattatatgcaggggccg-tgttcgaaccccggacaccccacttatt |
5381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 94
Target Start/End: Complemental strand, 43791 - 43748
Alignment:
| Q |
51 |
gtgagcatagttcagttggtaggacaatgcattataatatgcag |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
43791 |
gtgagcatagctcagttggtaggacaatgcattattatatgcag |
43748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 4904 - 4823
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||| |||||||| || || |||||||| | | ||||||||||||||| |
|
|
| T |
4904 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcag-gggcggggttcgaatcccggacaccccacttatt |
4823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 87 - 129
Target Start/End: Original strand, 2577 - 2619
Alignment:
| Q |
87 |
atatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
2577 |
atatgcagaggttgaggttcgaatcgcagacaccccacttatt |
2619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 48 - 129
Target Start/End: Complemental strand, 18030 - 17948
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| ||| |||||||| |||||||||| | |||||||| || | |||||||||| ||||||| ||||||||| |
|
|
| T |
18030 |
cccgtgagcatagctcaattggtagggacaatgcattgttatatgcaggggctggggttcgaaccccagacactccacttatt |
17948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 46 - 112
Target Start/End: Original strand, 159009 - 159075
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccg |
112 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |||||||| || || | ||||||||| |
|
|
| T |
159009 |
gtcccatgagcataactcagttggtaggacaatgcattattatatgcaggggccgggtttcgaaccg |
159075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0533 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0533
Description:
Target: scaffold0533; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 109
Target Start/End: Original strand, 9331 - 9384
Alignment:
| Q |
56 |
catagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaa |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | |||||| ||||| |||||||| |
|
|
| T |
9331 |
catagttcagttagtaggacaatgcattattacatgcaggggtcggggttcgaa |
9384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 129
Target Start/End: Original strand, 1036 - 1117
Alignment:
| Q |
48 |
cccgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| || ||||| || || | |||||||||| ||||||||||||||||| |
|
|
| T |
1036 |
cccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttatt |
1117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 41862 - 41801
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| | |||||||| ||||| | |||||||| |
|
|
| T |
41862 |
cgtgagcatagctcagttggtaggacaatggattgttatatgcaggggtcgggattcgaacc |
41801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 129
Target Start/End: Original strand, 12564 - 12643
Alignment:
| Q |
51 |
gtgagcatagttcagttggtagg-acaatgcattataatatgcagaggtcgaggttcgaaccgcagacaccccacttatt |
129 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| |||||||| |||| |||||||||| | || |||||| ||||| |
|
|
| T |
12564 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcagggttcgaacctcggataccccatttatt |
12643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Complemental strand, 109030 - 108983
Alignment:
| Q |
46 |
gtcccgtgagcatagttcagttggtaggacaatgcattataatatgca |
93 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
109030 |
gtcccgtaagcatagttcacttggtagaacaatgcattattatatgca |
108983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 7114 - 7053
Alignment:
| Q |
50 |
cgtgagcatagttcagttggtaggacaatgcattataatatgcagaggtcgaggttcgaacc |
111 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||| |||||||| || | |||||||||| |
|
|
| T |
7114 |
cgtgaacatagctcagctggtaggacaatgcattattatatgcaggggcgggggttcgaacc |
7053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University