View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2049_low_2 (Length: 442)
Name: NF2049_low_2
Description: NF2049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2049_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 18355424 - 18355177
Alignment:
| Q |
1 |
atgtgcatgcaaggaaatggaaaagagggttgttgtgtgaatccaaaagaagaagcgcttttcagaataatcgcttttcaggtttcgcttttcggcgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18355424 |
atgtgcatgcaaggaaatggaaaagagggttgttgtgtgaatccaaaagaagaagcgcttttcagaataatcgcttttcaggtttcgcttttcggcgctc |
18355325 |
T |
|
| Q |
101 |
tctctcactctcttcttgttgttgcttgttttcaggcggcggggaaacaatgaagcgaaggtttcacctttcaacttatacaacaagctaaacccacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18355324 |
tctctcactctcttcttgttgttgcttgttttcaggcggcggggaaacaatgaagcaaaggtttcacctttcaacttatacaacaagctaaacccacaaa |
18355225 |
T |
|
| Q |
201 |
caattaaataaaac--aaaatataaatattttttattttcttctaaaa |
246 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18355224 |
caattaaataaaacaaaaaatataaatattttttattttcttctaaaa |
18355177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 284 - 373
Target Start/End: Complemental strand, 18355107 - 18355017
Alignment:
| Q |
284 |
gacaaacttttatcatattgaattgtttccggtcttatgcaatattttatagatataatgtta-ttttagtatttttgacaaattgcactt |
373 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||| |||| |||||| |||||||||||| |||| ||||||| |||||||||||||| |
|
|
| T |
18355107 |
gacaaatttttatcgtattgaattgtttccggtcttatacaattttttatggatataatgttacttttggtattttagacaaattgcactt |
18355017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University