View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2049_low_8 (Length: 234)
Name: NF2049_low_8
Description: NF2049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2049_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 16 - 132
Target Start/End: Complemental strand, 9394842 - 9394728
Alignment:
| Q |
16 |
cagagaagatcatttggctttgttagagaaaataatgtgtatatttcttgactgatagtgaacatttgagctacaaacctatcaatacacaccctgtgat |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9394842 |
cagagaagatcatttcgctttgttagagaaaataatgtgtatatttcttgactgatagtgaatatttgagctacaaacctatcaat--acaccctgtgat |
9394745 |
T |
 |
| Q |
116 |
tcgtcgaccatcatgct |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9394744 |
tcgtcgaccatcatgct |
9394728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University