View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20501_high_2 (Length: 662)
Name: NF20501_high_2
Description: NF20501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20501_high_2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 2e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 2e-91
Query Start/End: Original strand, 75 - 319
Target Start/End: Original strand, 40465000 - 40465258
Alignment:
| Q |
75 |
attgccaaagtcaaatattgttggaacatagagtactgttccaactctaatcaaatagacaaaggtgcac-tacaggtactgcagaataggatgctgcaa |
173 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
40465000 |
attgtcaaagtcaaatattgttggaacatagagtactgttccaactctaatcaaatagccaaaggtacaggtacaggtactgcagaagaggatgctgcaa |
40465099 |
T |
|
| Q |
174 |
accagtacaaaacactatgcttaggagttgctctgccgagttggaaggccacttgcaag-------------attcaattggatggacctgcctaaccat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40465100 |
accagtacaaaacactatgcttaggagtttctctgccgtgttggaacgccacttgcaagaaacacttgcaaaattcaattggatggacctgcctaaccat |
40465199 |
T |
|
| Q |
261 |
ggaaccaacgttttgcagtttctattttttgccatgaatcatcaattatgaattaaaaa |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40465200 |
ggaaccaacgttttgcagtttctattttttgccatgaatcatcaattatgaatcaaaaa |
40465258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 592 - 640
Target Start/End: Original strand, 46205097 - 46205145
Alignment:
| Q |
592 |
ttcgttttcatcgatgtaatcaacgccggtggtttcgaggatttgagct |
640 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
46205097 |
ttcgttttcgtcgatgtaatcaacgccggtggcttcgaggatttaagct |
46205145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 137; Significance: 3e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 438 - 662
Target Start/End: Original strand, 3448852 - 3449076
Alignment:
| Q |
438 |
tacctgaatttttcacctctctttcaatccttatcattgttgcaccttctatgatcctacaaagcgcttcaccgaggttacacgcggagcttatgaacgg |
537 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| | |||||||||| |||| ||||| |||||||||||||| |||| ||||||||||| || || |
|
|
| T |
3448852 |
tacctgaatttttcacctctccttgaatccttatcatcgctgcaccttctctgattctacagagcgcttcaccgagattacttgcggagcttataaaagg |
3448951 |
T |
|
| Q |
538 |
tcttccgaaattatgtttgttgatgtgattctgatcatcggtgatggtgagagattcgttttcatcgatgtaatcaacgccggtggtttcgaggatttga |
637 |
Q |
| |
|
| ||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3448952 |
tgttcggaaattgtgtttgttgatgtgattctgatcatcggcgatggtgagagattcgttttcgtcgatgtaatcaacgccggtggcttcgaggatttga |
3449051 |
T |
|
| Q |
638 |
gctgagatgaaatgaccgattctga |
662 |
Q |
| |
|
||| || |||||| |||||||||| |
|
|
| T |
3449052 |
gcttcgacgaaatggccgattctga |
3449076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 592 - 662
Target Start/End: Complemental strand, 35039103 - 35039033
Alignment:
| Q |
592 |
ttcgttttcatcgatgtaatcaacgccggtggtttcgaggatttgagctgagatgaaatgaccgattctga |
662 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||| |||| || ||||||||||||||||| |
|
|
| T |
35039103 |
ttcgttttcgtcgatgtaatcaacgccggtggcttcgaggatttaagcttcgacgaaatgaccgattctga |
35039033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University