View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20501_low_11 (Length: 349)
Name: NF20501_low_11
Description: NF20501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20501_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 13 - 341
Target Start/End: Complemental strand, 24831085 - 24830764
Alignment:
| Q |
13 |
aagggtaaggctcagcttcattccatggatctatatgatacgaattggatgtctctgtgtacatttcattttacatgcatgcaaaatgagagcaaataat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24831085 |
aagggtaaggctcagcttcattccatggatctatatgatacgaattggatgtctctgtgtacatttcattttacatgcatgcaaaatgagagcaaataat |
24830986 |
T |
 |
| Q |
113 |
gattcatttgtgtgacgacttagtccttgttatttctgagggtagaagcaaatattatgcagtaaatagtgtcaagaatgttgatgatggttgattggaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24830985 |
gattcatttgtgtgacgacttagtccttgttatttctgagggcagaagcaaatattatgcagtaaatagtgtcaagaatgttgataatggttgattggaa |
24830886 |
T |
 |
| Q |
213 |
agacaaaaatgtttaattaaggtttccgattgcaccgcgattttgaggcttctggttaattttatgttgtaagcatctgtgtaaggtgattaaggttttt |
312 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
24830885 |
agacaaaaatgtttaattaaggttcccgattgcaccgcgattttgaggcttctggttagttttatgttgta-------gtgtaaggtgattaaggttttt |
24830793 |
T |
 |
| Q |
313 |
aagagggttaattgtttttcatgatgatg |
341 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
24830792 |
aagagggttatttgtttttcatgatgatg |
24830764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University