View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20501_low_18 (Length: 245)
Name: NF20501_low_18
Description: NF20501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20501_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 11 - 110
Target Start/End: Complemental strand, 43241580 - 43241481
Alignment:
| Q |
11 |
atgaaacgacaatgttgatccaatgccacaccttcttctctgttctagccgtttttccctttatcttcgattaaaacagaagtataaacaaattagtcgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
43241580 |
atgaaacgacaatgttgatccaatgccacaccttcttctctgttctagcagtttttccctttatctttgattaaaacaaaagtataaacaaattagtcgt |
43241481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 146 - 229
Target Start/End: Complemental strand, 43241448 - 43241365
Alignment:
| Q |
146 |
gttccagagacttatcttatatttatggacggagatagtaccttaaggaagatcatgcttgggaacatgaaggtaagaggaact |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43241448 |
gttccagagacttatcttatatttatggacggagatagtaccttaagaaagatcatgcttgggaacatgaaggtaagaggaact |
43241365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University