View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20502_high_13 (Length: 239)
Name: NF20502_high_13
Description: NF20502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20502_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 2691693 - 2691876
Alignment:
| Q |
19 |
ttgtctataactttattggatacactgcaaatataatatacctttaatctttttataagattcgtatctacgttacgtgtatccacaacatattctatta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2691693 |
ttgtctataactttattggatacactgcaaatataatatacctttaatctttttataagattcgtatctacgttacgtgtatccacaa------------ |
2691780 |
T |
 |
| Q |
119 |
taccatatatatcatggtctgcaacatcatattttgaaggcagtgactatgagaatgtaaactgcaacacaatttgttttatctcatgtttgataggcta |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2691781 |
-------tatatcatggactgcaacatcatattttgaaggcagtgactatgagaatgtaaactgcaacacaatttgttttatctcatgtttgataggcta |
2691873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University