View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20502_high_16 (Length: 209)
Name: NF20502_high_16
Description: NF20502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20502_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 16307005 - 16307185
Alignment:
| Q |
19 |
caagggagctctcaacataccttctcgtcactggtgacgtgcacgctttcatcgatcgactgcaaaaatacgaaagttaacatgaatatccacatgaaga |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16307005 |
caagggagctctcaacttaccttctcgtcactggtgacgtgcacgctttcatctatcgactgcaaaaatacgaaagttaacatgaatatccacatgaaga |
16307104 |
T |
|
| Q |
119 |
atgtgttcaagtaataaaaaatgcaaaaagattctgtagaagttataattgcagaagtagcactataccttaatattcttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16307105 |
atgtgttcaagtaataaaaaatgcaaaaagattcggtagaagttataattgcagaagaagcactataccttaatattcttc |
16307185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 34 - 106
Target Start/End: Original strand, 16296917 - 16296989
Alignment:
| Q |
34 |
cataccttctcgtcactggtgacgtgcacgctttcatcgatcgactgcaaaaatacgaaagttaacatgaata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || || ||||||||| || |||||||||||||||| |
|
|
| T |
16296917 |
cataccttctcgtcactggtgacgtgcacgctttcgtcaatagactgcaaatgtaacaaagttaacatgaata |
16296989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University