View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20502_low_6 (Length: 450)
Name: NF20502_low_6
Description: NF20502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20502_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 351
Target Start/End: Complemental strand, 54910248 - 54909898
Alignment:
| Q |
1 |
tgaccccttgtgggttaaaggtggaggccattgcaaccttgaaactttccccgagtacatcaagtatttgcgcaagtttatcaacgcaatggagaaactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54910248 |
tgaccccttgtgggttaaaggtggaggccattgcaaccttgaaactttccccgagtacatcaagtatttgcgcaagtttatcaacgcaatggataaactt |
54910149 |
T |
|
| Q |
101 |
tctatcacttcccaaacaaacaaacaactcactcagagtcctagtatcactgattccagacataccaaatgcttaggatttgttaaaagataggttcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54910148 |
tctatcacttcccaaacaaacaaacaactcactcagagtcctagtatcactgattccagacataccaaatgcttaggatttgttaaaagataggttcatc |
54910049 |
T |
|
| Q |
201 |
ttttttgaggtttcataatcagtttgtttatggaaatttaccctcaacttcaatagtgcccatgtcacttagtctttagcttcatgggtttttcaattgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54910048 |
ttttttgaggtttcataatcagtttgtttatggaaatttaccctcaacttcaatagtgcccatgtcacttagtctttagcttcataggtttttcaattgg |
54909949 |
T |
|
| Q |
301 |
cactcagtccaatgagtttattagaattataggatgtctaggacccgacaa |
351 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909948 |
cactcagtacaatgagtttattagaattataggatgtctaggacccgacaa |
54909898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University