View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20503_high_4 (Length: 247)
Name: NF20503_high_4
Description: NF20503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20503_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 11912817 - 11913046
Alignment:
| Q |
1 |
gacaacgaggaacgtaaagtctgagtgagtagtttaatgcagatgatgagnnnnnnnn-cggaacacccttttacaatctgagagttgtctgaaatcccg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11912817 |
gacaacgaggaacgtaaagtctgagtgagtagtttaatgcagatgatgagtttttttttcggaacacccttttacaatctgagagttgtctgaaatcccg |
11912916 |
T |
 |
| Q |
100 |
actcctctgctcgccggagttagggaccatattctagatcactgaaacaagcactatacctgc-aaaacaacacacaagtagtcatgtgtcagcaacata |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
11912917 |
actcctctgctcgccggagttagggaccatattctagatcactgaaacaagcactatacctgcaaaaacaacacacaactagccatgtgtcagcaacata |
11913016 |
T |
 |
| Q |
199 |
aaaccctacttccctaatacacccaaaatc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11913017 |
aaaccctacttccctaatacacccaaaatc |
11913046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University