View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20505_high_15 (Length: 324)
Name: NF20505_high_15
Description: NF20505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20505_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 33197038 - 33197188
Alignment:
| Q |
19 |
atattgatttatgtgatgtatatatgatactttttattcattcaattcgtgcatgcatgtgtgttcttacaactcatttaattaacaaaactataatata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33197038 |
atattgatttatgtgatgtatatatgatactttttattcattcaattcgtgcatgcatctgtgtttttacaactcatttaattaacaaaactataatata |
33197137 |
T |
 |
| Q |
119 |
aataaatcnnnnnnnnnnnaatttgaggcaaaatataacataaatcttgat |
169 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33197138 |
aataaatctttttttttttaatttgaggcaaaatataacataaatcttgat |
33197188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University