View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20505_high_32 (Length: 237)
Name: NF20505_high_32
Description: NF20505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20505_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 101 - 216
Target Start/End: Original strand, 31435229 - 31435344
Alignment:
| Q |
101 |
aaaacctctgggctaggtccattctatgggctttatattttgcaactaatctactttgcaagacaaagagaacaaggaaattcctttttggacccgttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
31435229 |
aaaacctctgggctaggtccattctatgggctttatattttgcaactaatctactttgcaagacaaagagaacaaggaaattcctttttcgaccccttta |
31435328 |
T |
 |
| Q |
201 |
attgctcacagccgct |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31435329 |
attgctcacagccgct |
31435344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 31435085 - 31435137
Alignment:
| Q |
1 |
ttttatgactaaaagtttagaagtatagtttaagaatattcaaaagcttttgt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31435085 |
ttttatgactaaaagtttagaagtatagtttaagaatattcaaaagcttttgt |
31435137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University