View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20505_low_13 (Length: 356)
Name: NF20505_low_13
Description: NF20505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20505_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 138 - 325
Target Start/End: Complemental strand, 30388388 - 30388201
Alignment:
| Q |
138 |
gttacagcgtggaaattatggaagtggataattaagaaaagcggtggtgtgacgttgagggagagatattagaggacggtaatgttttttgacattaaat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388388 |
gttacagcgtggaaattatggaagtggataattaagaaaagcggtggtgtgacgttgagggagagatattagaggacggtaatgttttttgacattaaat |
30388289 |
T |
 |
| Q |
238 |
ggagaattcttggaacagagaacttggtgatactgtttctttcttaagggattggacttttaatccttatccaagattaagatcccaa |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388288 |
ggagaattcttggaacagagaacttggtgatactgtttctttcttaagggattggacttttaatccttatccaagattaagatcccaa |
30388201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 30388522 - 30388429
Alignment:
| Q |
1 |
cgttgtgttgtttggttttgtttgaggggaatgaggtttatatatatagacacatgtagtgcgtgtttgttcttctaacattcggtgttacgtg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388522 |
cgttgtgttgtttggttttgtttgaggggaatgaggtttatatatatagacacatgtagtgcgtgtttgttcttctaacattcggtgttacgtg |
30388429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University